Description :
From Genome Similarity Track
Location :
Scaffold_580:3538- 8560
Transcript NameFunction/comments
g16008.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g16009.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g16010.t1hypothetical protein

Sequence
5022 bases(100 bases per row)
GCTGAGAACCTGCCCTCGGACAGTAACATGTCTGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGAAGACTGCCCCCACCTGTCGGAACCAG
AGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCGCCGACAGAGCAACACGGTGTTGCTCT
GGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAAATTCGGTGTCGCCATCGGACACACCGAGCGTGGAGTCATTGAAACTCCACGTAAGCAGC
TACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGT
TCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACGGACCCTACGTGCTTCAGCACGTACGAAGAGTTCAAGGAGGA
GCTCAAACTTGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGCGGGCGGAGTTCCTCGATGTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAA
AGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGA
CCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGC
CCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGA
TCAACGAATGTGCGTTGTTTCCGATGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTG
GGTATCGCCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGCGTCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGA
AGATCGCTGCCCCCAGTGAGATTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGTGAGAGAAGTCTCT
TCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGGCTTCGAGGAGGTGAAAACACCTCGAAGTCTATTG
GAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAAAAGGAGTTCGTCGACGAGCTTATCG
TCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGTACTT
CGGGAGCAGCAGCAGTGCGACAGAGAGCGATGGCGCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGCGCGGGATGCG
GCTGTCTCGGATCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGGAAATGTGAACCGAATCAGCAGGGCCTGATTCGATCGGATTCGAGAG
GGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACACGCAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGG
CGTATCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGATCAAGCCGGGCTTGAACG
CGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCGTGAGA
AGTGAATGGCGCAAGCGAGAAGAGCTGCGCAAGCCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCTGACACAGGAGTTGGAGACAACCG
TCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCT
CCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCTTCTCGGACGTCGAGAGGATGACGTGTGAAGCA
GAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCCAGGCGA
GCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCT
CGTGCCGGGAACGAAGTATTGCGTTACGCGACAGTGACCACTGCCGCGTGAACAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGA
CAAGTGCGGGAATCGAAGTCCCCACACAGCGCGCCTACGTTCTGTGTCAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCATACAACAAGCTGAACG
ACGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATATGAGAGACGG
GTTCTATCAGATCCTCATGCGTGAGAGCGATACCCCTCTCACAGCGGTAAGCACTCCGAACGGCATGCTCTGGGAGTGGCTCGTAATACCGCAGGGGCTG
AAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTAGGTGCGCGACTTCGCACCGAGCTATTTCGATGATGTGTTCATTCACAGCC
GGGTTGTGAATGGGAGATAGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTGTATGCGAACCTGAAGAA
GTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGATGAACGGCGTACGCCCTGACCTAGGAAAGGTCAGAGTGGTCAATGAATGG
CCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGT
CGCAGCTCTTAAAGAAAGAGGCTGCATGAGAATGGACTGCTGATTGTCAGGAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGC
GGTTGCCGACCAAGATCGTCCATTCCACGTTGTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACACGATCACGAAGGTCGTGATCGT
GTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTC
GAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATAGCCCAAAGAATGGCACG
GTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCG
GTGCAAGAGGCCAACGCTAACGCAGTCGGTGTCGTCAGGACGACTACACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCGTACGCGCATGATGCGG
ATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCGTCGTGCCCGTGTACACCGTTATCGTGTACA
CAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCAC
GATGCCCTGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAATGGGTACGCAAGTACGT
TCGTGCTTGCGAGGTATGCCATCACGTTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTC
AATGGACTTTGGTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTTGTTGGCCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTA
CCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTTGACCTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCTGC
GCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACCGAGCG
TGTCAACCGCGTGTTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATCGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCG
GTGCATGTCTCGACAGGACACCCACCCTCCTTCTACGTGAATGTCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAATG
GGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGTACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGG
CGACGACAATACAGTGTCTACGACGGGCGTAGACACTTTGAACCACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAAC
CAGGGGTTCAGCTCGGATGCAA