Description :
From Genome Similarity Track
Location :
Scaffold_2:353760- 355355
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001048Protein of unknown function
Pytul_DAOMBR144PYU1_G001047Similar to UVRAG: UV radiation resistance-associated gene protein (Homo sapiens)

Sequence
1595 bases(100 bases per row)
ATTTTCACTCTTGCTAGCGTGTGTTTGCTGCATTCGTAAGGGCGAAGTTGATGGCCGCTGTGCCTCAGTTCGCTTCATGCCTCATTCTCATACGCACATG
CTGTCTGTGTCACGGGTAATACAGGATGCAGGTGATGCAAACTTAGTCTGCAATCCGCCTCCTGACTGCGAAGTGATTCCAAGAGTCGCCACCTGGAATA
CGAGGTGACCATGAGCGCCACCTGTTAAGCACACCCAACGCAGAATCTCCCCCGTGGGGATGGGTGTGCTCGAACACGATTAAGCTCTGCTGTGCCTACC
GACCGCGTCCGGCGTCGTGCATGCGATCGCCCTGAGTGCTCGCATCCGAGTGTAGGTCGTCTTCGTTCAGGTACCGTGGTAATTGTAATCGCGATCGTTT
TAAGCGTCTTCCGCTTCCTGGATCCGAATGTCTTATCCCTGGGCCTCCGTGGCTGCTTGGTTGCGTAACTCAACTCACTGTCTTTCAGGATATGGCGTCG
TCACCCAAGAGAAGCTCCGTCGGCTGTAGCAGGTGTCCCTGCGCTTTGCATGTTTGCATGTTTACGGATACCTTGCTCGCTTTAGGCGTAACGTAATATA
CCTCACTGAAAAACGAGGTGATGTAAACCGACGATGTAGTTGCCGGTCAGTTTGAGTGTCCACCTCTGCACGACAACATATTGCCGAGCAGTGTCCTCTC
TGGGAGAGCAGTCAGGTACAAGTACCACTGGTACCAGTGTCAGACTCAGATTTGCTGCTTTTGTAAGAAATTTCGAGCCGAGCCAGACCGAGCTTTTGGC
TCGGCTAGATTCTATGCATTTATGGTTCTAACTCCAGTATAAAAATAAAGAAAGAATCGGTTAGTAGAGATGGTATGCAACTGTACATACTCTACGAGAG
AACAATTTGAAGCTCATGGAACCGAAGACCGAGTGCGCGCTCTGCACGCGCAAGCGCAGCGCGTTCTCGTGCGCGCGCTGCACATCCGACATGCTGCAGC
AGCGGCGCACGATGCTCGCGGCGCTACAGGCCGACGTCGCAGTGCTGCGTAAGAAGACCGAGTTTGCGCTCAACGTACGTGACGAGAAAGGAGTGAACGC
TGTTGTGTCTTTTTTACATGTTGTAATACGCGTGTGTATGAATGGGATTGGGGTGAAGTCCAAGAGCAGCTTGGTGGATGCGGAGAAAAGACTCGACGGC
TGCATGAAAAAAGTCGAGGTGCTTGCCGAGAAAGTGATGAAAACCAGAGAGCAGCTCTGCAATGGTAGCGTGTCTGTTGCTGCTACGTTGCTATGACCAC
CTGCTGAGTGACGGAGCTAATGAACCATGCTTGTGCTCGCGGATGCGCCTCTAGAGCGGATAGCGATCGTGGAGCGGACATCAGCCATGGAGGAGCGCTC
GGAGCGATTGGAGCTGGGACAGCAGCTGTTGCAGAAGGAGACACAGCGCTCGCGCGGGTTCCACGAGCCGCTGCTCGAGTGTCTAGACTTCCAAGTGCAA
TGGGCGCACGAGGTGCGATGTATCTTGCTGTTGGTTTATGATATGAGAATGTTTATTTGACTATCGTTTCCAAATAGAATGCGGCCAAAGTACGT