Description :
From Genome Similarity Track
Location :
Scaffold_179:3537- 7292
Transcript NameFunction/comments
Phypl_g4784hypothetical protein

Sequence
3755 bases(100 bases per row)
GAAGGTGGCGGAGTTGTCCTTGACGTGATCCTGGTAGGGATGAGTtgagcccccccccttcGAGTaggacgaggccgcggctATTCACTGCATGTTGCTC
ATATGCTTGGAGCCGCTGACGATCTTGGACGCGAGCGATGACATGGATTCCTTGCACAAGCGAGTGTACTACTTGAACGTGTCCGAGGCCCAGCGTCCAT
GGAACTGGATTGTCAGCGCATCGACGCCCGCTCGACACATGTGTGTCGCGCCTCCGGACCCCAAGGAGTGTGCGCTGAAGGCCTTTGTGCACGATACACA
CTCTGGTACCCCAAGTTTGTTCAGGTACACCGCTGATGGAATGTTCAAGGGCAGTGACCCTCTCGTCTTGAGCAGGCATAGTGCCCCGAACACTGGGCAC
ACGACGCGATGGCAAGAGCGGTTCAGGACTCGCAGTGTCGGGTCCCCCTGTTGGTTTGGCTTTGATCCAGTGAACCTGATGTGAACAGAGGTTTCTGCGC
TTGAATTCGAAGTAGGATATCAGCCTTGGCCAATAGGAGCGATGTCTTCCGCCTTAGCACGAACCATGCAAAATTCCCGTTTCCAAGCGTTGCGATGTCG
GAACGTCGCAGtaggaagaagaaggccagaCACAGACCCCCCCCCGCAGAGAGCTTGATCGCAAGGCGTCGTCATGTCGAGGGAGGCGAAGCAGAGTTCG
AGGTGGTAAATGGGGACGGGGGGTCGTGTGTCGGACCGAGGCGTCGAATCGACCGATGCCTTTTAGGAGCATGCGAATCTGTGAGTGGCCGCACGGAAAA
TCGGAGCCAGCCGCGACGAAGAAATGACGGATTCCGGTCAGTGTTGATGGGATGGTCGCGCTGCGGACCGAGTGGCCAGAGCCGTAGCCTTCGCGGAATC
CCAAACGAACGAAGTCGGTGATTAGCTGAACACTGGTTGTGAGAGGAAGATGGCTGAGGGTGGGAGAGGTGtgtcggcgacggcaccagTTGAACCATTT
GCGTAGAGCCTTGACGTACTAGTTACAGCGACCGAGTGTGCACGGAGATAGAAGTCCAAATCGTGTCCAGATCGGTAGATGTGATGTTGGGGGAGACCTG
TGTCGAACCACGAGTCAACGTCACAAACAAGTCAGCACTGGTGGCGCATTTTGGCCTGCGCGAACCAGCGTCCGCGATTGAGTTTTCCACCCCGGCAATT
TGTGAAGACGAGAACCGAAGACTCCACTACAAGCTCAGGAGACGAATGGCGGTATGAGCGCGAATATTCCGCGATGCCATCTTGCTTTGCCAACTCACGG
CGGACGTGTTATCGATGCCAAAATGCACGTACAACGGAACGGTGCCGCCGCGAGCCTCGAGAAGGGTAGCCCATGATTGTCCCCAGGCGTGGACGGCGAA
TGCACACGACAATACCGCGCGGTAGTTGCTGTCGAAGCCGATGCTGGGAAGTGCTTTGGACTTCTGGATCAGTTGTTGCTCAGCGTCGGTGAAGGTGTAT
GTCAGCGCAACCTTGTCGCTGGAACGAGAGCGCACAGTCCCGCATCGGATGTGTCCAACTCGACGATGACGTCCATTGTGGGCAGCGTGCGAAAGAAGGT
GAGCGGCACGCCATTGAGCGGTGCGGAGCGAATGCTGCGTAGCCACCAGTGTAGGCCGTCTTTCATGACAttcgcgacggcgacggtTTGGTGACGATGC
AAATGTCGCTCATGTTGCCGAAGTCGTTGTAGGAATGCCCGTGCCGGGCGGATACAAGTAGCAACGTGTCGTAAACAACCGAATAGAGATCGGTATTCCG
AACGACGAAGGGTTGTGCGAGACAGGGCTGCAGCCACGGTGGCCACCGCCTTAGTCACCTTGGCGGGAGGATCGACACGGTGCCCGCGGCCGAGTCAAAA
ATGAGACCTAGAGCTTTTAGACGAGTGATCCATCCAGTGAACTTGTCCTCGTTAATAGCTGCCGGGCCCAACACCTGCAGCATAGCGTGCCGCAGTGAAC
GCTCCATGTCTTGGCAGTTGGAACTGATGTCAGCACCCACGTTGATATGATCGTCTACCCAATGGTAGCTAAAGAAGCCACGTGGGTTGAATTCGTTCGT
GGTGTGGCCGTGGATAAATGAAGTTGCCCCTCCGAAAACACCGTAGTTGCCTGGGAAGCCGGACCAGCCGAAGTCTGCCGACATGTCGACCACGAGCTCA
TTGTCATGGTGCAAGCGACCATCGACCATGTGTGTGCAGTGGCTATGGATGCATACGTGTCAGTAAGCCGACGCGACGTCGCCGGCTTGTTTCTTGATCT
CACGGCTGGGGCGTTGGACCTGCTGGCACACCACCTCGGCTGCGATAGCATCACTCCCAATGCTCGTATATCGGTGAACACACAGCGTTGCGATCGGTGA
CGTCGTTGAGGGAGCTGTTAGCTGGGTACGAAAGACCATGAATAATCCGGCCTGATATTCTTGGATCTTCGTTGCCcttgtcgacgacgccgaatGGGCT
AATGTGCACTTCCGGCCACATCTCGAGAATGTTAGCGTCCACTACGAGACACTGCCAGGCGTCCTGTTCCTTGCGAATTGTTTTGACGAGGATGTTGTAC
CGGTCGTCGGTCGACCTGTGATTCGGGGGACGCGTAGTTTGTCGTGGTAGTGGGCTGGATAGAGGTACGCGAACACCAGATCGAGCAATGTCGAGAAAGC
ATGGGAGGTGCTCGTAGCCTTGGCAGGCAGCGCTCAGAACGGATGGAACCATGCTCTTGTTGAGACGATAATCATCCGCGGTTTGGCCACGCCAAAATCT
GACAACTTGATGCGAGTGCGGCGGACGAACTCCGACTGTGTCGCTTGGAGATGCTTGTTTAGGAAATAGACCCCGTCCCGATCAGTGCACGAAGCATCCG
GAAGCGACAAGTCGACTGCACGTAGCGCGCTATTGATGCGGCGAAGACGGATGGCCTCCCACAGTGTTGCGCGATGAACGGCTTCTGCGGCGTACTGCCG
CGACGCAGCGACCGAAGGCGCCGATCGTATGCCGGTCCGCGGTGATGGCCTTTGTCCGGGTGGTGTCCCGATGCATCGACGCTGTGGATCGCAGCTGATA
CCCGTGTTGCGCCTATAGGAACCGTAGTTGTAGGTTGGAAGAATGCCGGCAGTCAGACCAGGTGGCactggtggtggtgtggaGACATGGGACGTTCGAA
GCCGTTCCGCATTGCCGTGGGGCTAACGTATATGGGGGGGGTCGCGTTGTGAAGCCATAGGGGCCGAGACGTGTCATGGGGCGACGTCCCGGCGGCGCCG
GAATCCGCACGCGGCTGCATATGAAAAGACGCGCTTGCAGCTAATGAAACTGGTGCAAGGCGATCGGAATCACGATCCGGGCGATGACGACCGAGCTGAG
GCTCACTAGCAGAGGAATACCCTTGGATTATACATGGAGATACACTGCTTGCCAACCGAAGTGGCGGCGATCCTGCGTCACCGCGGCCACCTCattggcg
gcggtggcgtgtGTACGATCGGGGTTCGTGGTCTTGGCCATAGTGCCTGTCGATGAAGTCCGGAGATCCTGGGGAAGCCGGCGGTGACACTGGTGCGTAC
GGCGAGCGTGGGCACAGCggtcggtgctgctgccgtagCACATTCCGCTGTCCAGGAAACGCAGGCATGGTTCACGGCCTTCGACGTCACGGGGAATCTG
GCGCCGGATATGGTCTGACATCATGGGGCCACTGCCGGTCGGGGTCCCGCGCGAT