Description :
From Genome Similarity Track
Location :
Scaffold_425:35362- 36867
Sequence
1505 bases(100 bases per row)
GACATCGGCAACCGCGTTCCAAGAGACTGGAAGAGCTCGGACCAGAAGGCGGTGGTAAAACGGAGTTCTCGATCAGACACAATCGAGGACGGTAGGCCGT
GGTGTCGGTAGACAGTGTCAACATTGATCGCCGCCGTCTGCGCCGCGGTGATTGTAACGGCAACTGGAGCAAAGGTGGACCATCTTGCTGAGCCCGCTGA
CGCAAACAAGGATATGTATTAGTGCGACCTTGTATGTCGCTAGGTAGCCCGACGACGAAGTTCATGCTCACCGAGTTTCACGCGTCCCGTGCGACGGGAA
AAGGTCGGAGTGGAGCTTGTTTCGACCCAGCTGGTTTGACGCGCTGGCACGCTTCACAGGATCGTACCCACTTACGCACCCACTTGTACATGTGGGGTCA
GTAGAAGTCCTGAGCAAGTGTCGCGAAGTTTTCTCGCGACCAAGGTGTCCAGCGCTTGCACTATCATGAAACTCGCGGATGATGCGAGCTCGAAGGTCAT
CGTTCAGCAGACGACGCAGTATGTCAGCAAGTCGCTATCCATGGCGTATCGGCCAATACGAGAACGGCTCCACGGGGTTAACTGGCGCCGCGCGGAATCC
GACGGTGCCTTCGGGTACTTGATCATCTCAGAGCACGACGAATCATGCTTGTATGCGTCAGCTATCGCATCACAAAGCTAGCTAGCTGCTACGATCTCTA
CAGCGGTAAACTTTGCAGCAAGGCAGACGGCACATTCATCATTGTCCTCGCTGTCACAAACAGCGTGACGGCCCCATTGGGAGCGGGAATCGTAGTCAGG
ACGACGCGACAGCGCGTCAATAAGAATGCTGGTCTTACCCGGCTTATAATACACGACGAAGGCGTACTCGGCGAGCAGTGACAGCCAGCGGGCCAGGCGC
TGGGACAGATGAGGGCTTTTCGTCGCGGTCTGCAGTGACGTATGGTCAGTGTAAACAGCGAAGGTCTCTTTACCCAGAAGGTACACGCGGAGCTTGATGA
GATCATAGCGCATGGCAAGAAATCCCTTGTTGTGGACGGGATAGTTCCGTTCTACCAGCTTAAGCTGACGTGATTGGTAGCTCAACACGCGCTCGCATCC
TTCGTCGTCGAGCGGCATCAAGGCGCAACCGATAGCGAATTCACTCGCATCGCAGACGAGGTGGAATGGCTTAGAGTGAATTGGGCAGCATCAGGACTGG
CGCGGTAGCTAAGCTGGTCTTCACCGCGTCGAAAGCGGCCTGATGTACCGGACCCCACGACCACGCGGCGTCCGCCTTGAGTAGTTGCGACAAGGGCGAG
CAGTCATCGCGGAGCTCTTCGAGTAGTTATGGAGGTACGTTGCGAGACCCAACCACTACCTGAGCTATTTCTAGTCTTGATGTGTTGGCCAGACGCAAAT
AGCTTCGATCTTCTCCGGGTCAGCACGGACACCGTTCTTGATGCCATAGCTGCCGAGCACGGGTATCTCGGATGCGCAGAAGGTGCACTTCTTCAGGTTG
GCGTA