Description :
From Genome Similarity Track
Location :
Scaffold_208:35361- 37897
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.11Verebrate palmitoyl-protein thioesterase 2 (PPT2)

Sequence
2536 bases(100 bases per row)
CAACTAGAGAAGCAGGTGCTAGGACGCTTTATAACCCATGATTATCTAACACGCGATGCaTCGTTTGACTCCTTACACAAAGACTGGCGCGACGTtAGCG
AGATAGTTCGGCTCGAACTTGCACTCCTTGGTCTGAGCGAGCGGCACGTAGTCGAAGAGCCAGCAATCGTGGCCGATGTCGGGCACGACGTGAAGGAAGA
GACGTCCACTCTtGTCCAGCGACTGGAGACCGAAGAGGTCACTCTTGTACTCCTCCGTTTCGCGCGTGTCGAGCACCTTGAGGGTCGAGAACTGCGTCTC
AATGTCGTCCACGGACGCGAGCTCGCTGTATTTGGTCAGCAGACTGGTCTGCCATGGGCTCTGGATGTCaTCACCCGGCGATGCGAACAGATGAAGCGCC
TTCAGACGAAGGAAGTTGTTCTTGCGACGCCGCTGATTCTTCGTGCACGTGGCGTCAGCGCCACAGACCTGCAGGTTGTTGATCTCTGGGTAgAACGGGT
TcACGGTGAGGAAGTTGGTGGCGCTGTTGCGCACCGGAGGGAACCACGAGTTGAGCACCGTGTTgTtCTTTTGGAGCTCTGGGTGCGAGAGCACGAACTT
GGTGAAATCGAGTTGGAACTTGCCATTGTATGTCGTTGGATCCACCTGGTACTTGGTGAAGTTGAACACCGTGTCCGGCATCACGAACGGACCGAGGGCC
TGGAaCAGCACCTGCAGTGGCGCGCCGAGGTCAGACGCCTGTGGACCGTAGAAGTTGCCGTagCCATCGCCGGCGAGAGCCACGAGCGAGTGGATGGCGT
GGTCGTCCATTTCTTCGGCCACGCCTCGGGCAATCACGCCGCCCTGCGAGTGTGCGAGGAGATGGTAGCCGTTGGCGTAAGTGGCTGGCGACTTGGCGAT
GATGCCGCGGATCTGCTTGATGGCGAGCTGGACCTGGTCGTTCAGAGCCGTCTCGACCGAGCATGCGACCTCGCAGAAGTCCAGTGGCACGTACGTGTGG
CCGGCAGCCCTGAGTTGCTTGCCGATGTTGTCGCCGTTGGTGTGGTTGCCCGTGGCTCCGTGGAAGAAGAAGACGGGAAGGGCGGCATCAGCCACTGTGG
CGACGATGGCCGAGGCGAGGAGGAGGAGCTTCTGGCCGAGCATGTGGTTGGCCTTGGTCGGGAGATTGAGGAATGAGACGGTGAAGGAGAGTCGAGTTGA
ACTCGTTGGTTGGAAGCCAGCGGCTCGGGCATCATCATCATGACGATACGTCCGCGACGAAGCATGCGGAAGATGCGACGCCCGCCTCAGACAGACGATC
AGTTGACAGTCGCGCGGCAGATGATGGCTGATGATGGATGCGACGACCACGCGACGCGGACAGTGCAGCTACTGCATCGAAGTCATTACTTCAACATCGA
CAGACATGGATTTCCACTTACACAGGTCGAGCTACTGCACTGTACTCGGCCGTTCATTGCCGCAGGTTTGCATTGCTGCCTCGTCCGCGCGTAGCCGGTG
TGGCGCCTTGCAACGGGGCGCTAAGGCGGATCGGCGGAGCCGTTCTGTGTGCTGCTCGCTCGCTTGGTGACGCACTGGCGCCGTTCCTGTCCGCTGGCGC
CGCTGTCTCAGGTGCAGGCGCTGGGCTCGGCGTGTCTCcACTCGGCGCTTCTGTCGTCGCGGCGGGTGTTGGCTCGGGTGTTGctGTagTTGGTGCTTCC
GTCGCAGGTGCCTCAGTGaCCGGCGCTGGAGTCTCTGTAGTGGGTGGaGCAGGCGTCTCGATAGCAGCAGGATTCATTGTCGGTGTAGCAGTAGCAGCCG
GTGGCGTGACTGCTGCAGcGGCCCCcACGGGCACTCCTGCGGAAGGGCTtGTGGCTCCGGGTCCCGAGGGgCCTCCCGCGGCAGCTCCTAATGGCGGTGC
TGGACTCGCtCcAAGACCAaCCGGACTTACAGCTCCAGCGCCTCCAGGCACGCCGAGTACTCCTGGAGTCGTGGgTCCTGTCGGCCATCCGCCGGCACCC
cACCACCCAGGACCCCACCcACCAAGGCCaCCGAGCCCGCcccAACCTCCTCCccAACCCGGCcACCCACcGGCGgTTGGTGCTAGTGgTCCGGCACCCT
GcGTCCCCATGGCAGTCGGCTGCTCGCCCGCGCTCGTAGTATTAGCACCCGTGATCTGGATGTTCGCGAATGTGCTGCCAATGTTGACACCTCGGATCTT
cgAGAACACATTCGACTCCTCCTTGTCCTTCTTCTTCTTCTTGTGCTTCTTGTGCTTCTTGCACTTCTTATGATGGCGGCCATGGCGACAGTGCGTTTTG
TCATCACTTGAGTCGTCACTTGAATCATCACTCGAATCGTCGTCACTGGAATCGTCACTCGAGTCGTCATCACTGTCGTTGTCGTGGTGCTTATGGTGCT
TCGTGTGCTTGTCTCGAGGTCCTGACCAACTCTCAAGGTTCTTtGATTGCCTATTGAAGgCAGCTTCAGCTGGGTCAGATGTTGGCAAAGACTGCTCGCC
ATtGCCTTCAGTTCTCGACTCCGCAGCGCTCTCTTG