Description :
From Genome Similarity Track
Location :
Scaffold_1316:3536- 4990
Sequence
1454 bases(100 bases per row)
GGAAGACGACTCGACGCCCCAACCGGCAGCTGACGGCGCGTCCAGAGACGGTACACCAGTTGCGTCATCACGTGATTACGGTCAGCGTGTCACGTCATCA
ACTGATTACGCGTGCAGAGACGGGACATCAGACACTCGACTACCGGGTGAAGTGCCAGATGCGGGAAGGGGAGATGCGACAAGAGCCAGTGGCGACGCTT
CTCAACCAACAGACGATTACGCTGGAGTCCATCCATTGGCGCCCGACGTGCCAGTCGAACGAGACCCGAGTCCCGAAGCACTTCAAGCGATACGCGCCGA
GAGAGTCGAGCGAGCTCAACAGGAGGAGACATGGGCTGTTCACCTGAGGCTGTACCTCCGGGGTCAGTTAGATGCATTGGATGACCAGCAGATCGCGTCG
TGCGCGAAGCATGCCTCTGTCTTCGAAGAAGTGGATGGACTTCTCGACTACGTGGGCGTGCGCAAGTCGCGAGGCGGCTTGGCCGAGGAGCGCGAAGGCG
TGAGCGAGATGCGTGACAAATTGTCCTCGAGTGCGCGTAAGGAATTGCACTTGAGATTGGTGATACCTACGACTCTGCAGTCCGAGCTGCTACACCACTA
CCATCGTAGCCTCAATGGCGGCCACCAGGGGATTGCAAGAACGTTCGAGCGCGTGAGGAGCCACACCTACTGGAACGGGCAGTACCAGAGCGTGAGAGAC
TACATCGCGGCTTGTCCGGATTGTCAGTCGGGTAAAGGTGCTCCGCGCCTAGATGTCGGTTCTCCAGGCAACATCGCAGCCACACGTCCGTTCGAGGTGC
TGGGAATGGACCACGTGCCGTCACTCCCCAAGTCGCTACGTGGAAACACGGAGCTGCTGGTGTGGATCGATCAGCACACGGGATATGTGATCGTCTCAGC
CAACCCGTCTCGGAAAGCAGAAGTCGTGGCCGAGGCCAACGAGCGCTGCGTGTACAGACGCTTTGGCGCCAGCCGCGTTATACGTCACGACCGGGAGCCC
GCGTTCATGTCTGAGGTGTTTAAGGCTTTTAATCGACTGGTGGGCCAGCGCAGCCGCGCGACGCTCGCTTACCGCCCCCAGGCGAATGGGATGACCGAGC
GTATGGTTCAGACGATTATGCGAGCCGTTCGACTGTACGTGTCTGACCCAAAGCAGCGGGACTGGGACGACTATGCAGAGCGATTGGTATTCGCGCTGAA
CACGGCCTATGACCGCGTCCGTCAAGAAACGCCGTTCTACTTGCTGCACGGTTGGGACCCGTACTCAACGATCGAGACGAACCTGCCGACGGAGGCGGGC
GAGAGAGGGCATGTTAAGGCGCGCACGTGGAGAGCTCAAGTGCAAGTGCAGTACCGGCAGGTGAGGGAAGATGTGAATCGCCTCCTGGATGAAGCTAGGC
GGNNNNNNNNNNNNNNNNNNNNNNCGCAGCGGTCGAGAACGCGCGGGGCGGTGA