Description :
From Genome Similarity Track
Location :
Scaffold_524:3535- 6529
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_524-abinit-gene-0.31ATP-binding cassette sub-family F member 2
Pytap_DAOMBR444maker-pag1_scaffold_524-snap-gene-0.14Serine/threonine-protein phosphatase

Sequence
2994 bases(100 bases per row)
AGGCCGTGCTGTCGGTCGACGAGGAGCGCAACAAGCTCCAGGCCGAGGCCGATGAGCTCTCGGAGCAGATGCTTGATGAGTCGCTGAGCGAGGAGAACTC
GCAGGCGATCTCGGACCGGCTTACGGACATTTACGAGCGCCTTGAAGAGATGGACGCTGATACGGCTGAGCTTCGCGCGCGCTCGATCCTGTCGGGTCTG
ACGTTCTCGGACGAGATGATGCAGAAGAAGACGCGTGACTTCTCCGGTGgTTGGCGTATGCGTATCGCGCTTGCCCGTGCGCTGTTCATTCAGCCAACGC
TCTTGCTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGATATGGAGGCCGTCG
TGTGGCTTGAGGACTACCTGTCCAaGTGGAAGAAGATTCTGCTCATGATTTCGCACTCGCAGGAGTTCATGAACGAAGTCTGCACCAACATTATCGACCT
TACGCAGAAGAAGCTCGAGTACTACACGGGTAACTACGACATGTACGTCAAGACCAAGGCCGAAAAGGAGGAGAACCAGATGAAGCGGTACCAGTGGGAG
CAGGACCAGATCAAGCACATGAAGGAGTACATTGCGCGTTTCGGTCACGGTAGCGCCAAGCTCGCCCGTCAGGCGCAGAGTAAGGAGAAGACGCTTGCCA
AGATGGTGCGTGAAGGTCTCACGGAGAAGGTCGTGAGCGAAGCCGTGGGCGATTTCAAGTTCCCAGACCCCGAGCGTCTCCCTCCTCCAGTGCTCATGTT
CCAGAACGTTTCGTTCGGTTACCCAGGCTCGCCCCTCCTGTACTCGGGTGTTGAGCTCGGTCTGGATCTTGACTCGCGTGTGGCTCTTGTTGGTGCCAAC
GGTACGGGTAAGACGACGCTGCTCAAGCTCATCACTGGTGACCTCGTCCCAGTCAACGGCAACGTGCGACCACACAGCAAGCTCCGTGTGGCCCGCTTCA
GCCAGCACTTCGTCGACGTACTCGACCTGACGCAGTGCCCACTCGACTACTTCCGCTCGCTCTTCCCAACCAAGTCGGTGGAAGATGTGCGTAGCTACCT
CGGTCGCTACGGTATCTCGGGTGAGGTCCAGACGCAGATCATGGGCCAGCTCTCGGATGGTCAGAAGTCGCGTGTCGTCTTCGCCTACATGGCCCAGCAG
AACGCGCACATGCTTCTGCTTGATGAACCGACGAACCACTTGGACATGGAGTCGATCGATGCTCTTGCGCGTGCCATCAACAACTTTAAGGGTGGTATGC
TCCTAGTCAGTCACGACATGCGATTGATCTCGCAGGTGGCCAAGGAGATTTGGCTCGTCGAAGACCAGAAGATCCGCGTGTACGAGGGCGAGATCTCGGA
CTTCAAGATGCGTGTGCGTAAGCAGCTCAAGCTTGCGGATAAGCCTGCAAAGGTTGAAGAGTAAGCGTTCCGATTTCCGAATTTCCCCCcGATATGTTGA
TGAATATAGACAAACACCAAAGGCCATCATTGTTGAGATCTCAGTCGTCCTCGGACTGATTGTTATCATCGTGGACCGCGCTCAAGCGGATGCTTCGTCG
ACGTACAGCTACCAAAGGTGCGTCGTTGCTGCCTCTCTGCCGAGAGCGTGGCGAGTCTTCATCGTCTGTGGAATCAGACTCGTCCTGCGACGCCCGTTGC
TGTCGAGACGGAGAGGAAACAGCAGGCGATGCGGAAACTACAATTGATCCTGAACGGCGTCTTTGGACAGGAGAGACCAAGGGAACTGCCATCCGGTCGT
CGGTGGGACTCGCTGCAGTGGCTGAACCGTGTACTACACCATTGACTGCGAAGTTCTCAGCATGTACTCGATCACCGGGTGCTGGAGCGGGTGCTGGACG
CGGTGGAGACTGCAGGCTCGTGATGCTACGTCGCCTCCGCACAATTTGCTGTTGACCTGCCGAGCGGTTAATGGGAATGATCCGATCTCGGTCTACGAGC
ACACACCCGCAGGACGCATCGTCACCGAGTCCGTGATCCTTCGAAGTTGAAAAGATCGTGAGCACGCGAGCGCTCTTGGCGACACTCACGCCGTCAATCG
TGGCTTCGTGGGCTCGGAGGATGTAGCTGAGTCGATGGGAGTGCAGGAAGTCGTCGATGGCTTTCGAGCCGAAGCACACGGCGTTGCCTCCACGCTGCAC
GCTTTTACCGAAGCCTGTGGTTGGGTCCAGCGCTGCCTCATGCTCTTCCTTGGCTGGGTCCGCCCACAACATATCACTGACCATCCGAAGTGCTGGGTTC
GCGTCGTAGAAGCGCTTGTCCAGGATGTCCATCGGTGCTGTGGTCGGCAGTCGTCGGATGGACTCGAGCAGCGTCATGCCATCGACAGCACCAACAGAAA
GAGGACGTGGGATGCCACCGTGGACGCAGAAAaCCGAGCTATCGATCGTAGCCACCAACGGCAGGCGATCGAATGCGTGGTTGATCTGGTGCCACACGAT
GTATCCTTCATCACGCCCGAAGCGCTGGCGACACTGCGTCAGGAAGCTGCCGCTGCCGTAGTAGTTCTCGAGGCCATTTACTGCGCGAGTTTCGTGGTTG
CCACGCAGTAAAAAGACCTTCTTCGGGTTCAGCAGCTTGTGTGCGAATAGGTAGGCAACACACTCGAGCGAGGAGAGCCCACGGTCGACGTAGTCACCGA
GGAAAAGGAACGTGCCAGCGGTGAGACCGAAGCCGAAGCGCCACAAGTGCGACGAGAAGAACGACAGATCCGAGAGGTTGCCGTGGACATCGCC