Description :
From Genome Similarity Track
Location :
Scaffold_96:3535- 4585
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_96-fgenesh-gene-0.1Cathepsin B, cysteine protease family C01A

Sequence
1050 bases(100 bases per row)
CTGGCACTTGCGATGGgTATCTCCACGGCCGCCAGCGAAGGCTGCAAGTGCCGTCGTACGATGAAGGGACGTGAACATCTGCACCCGAAGCTCAATCCTT
CGGCCGCACTCACAGCTCACTCGCTATCGCTCGCGCAACAGGAGGAAATGAGCGGCTTCCCAAAGCACCTGGACTGGTGCGAGCGTGGGTTCTGCGTGCc
TTCATGGAACCAACACATTCCGCAGTATTGCGGCTCGTGCTTCGCCCATGGAGCCATGTCCAGTGCGCAGGACCGTATCAAGATCCTCAACACCAAgCGG
GGATACTCGGGCGCCGACGTTATGCTCGGCCGACAGAGCTtCCtCAATTGTGCACCTGGCCATGGTTtGTCCGCAGGATGCGACGGTGGCGAAGCGTCGG
ATGTATACGAGTTCATGATGCGCTACGGGCTTCCAGACGAGTCGTGCCTTCCGTACAACGCGACGGACCACACCAAGTTCACCGCCACGAACGGTACTTG
TCCGCCCGAGGGCTATTGCATGAAGTACGTCGTATGAACCAATGGAATTGTGGTCGCTCTGATAACTAACCGATTGTTTTAGTTGTATGTACACGCCCAA
GAGCCCAGGGAAGGCGGAGTGTTTTCCTGTTACCAAGGTCGTTCGTTATCGTGCCAAGCGCTATGGACACATCGCCGGCGAGTATGCGATGATGAAAGAG
CTAATGAAGGGACCCATCACGTGCGGTATCGCTTGTAGCGATGGGTTCACCTACGAGTACAAGGCAGGTATCTTTGAGGACACAACTGGCTTCATGGATA
TCGACCACGACGTGGAAGTTGTGGGCTGGGGCGAAGAGAATGGTGTCAAGTACTGGCACGTACGCAACTCATGGGGCACGTATTGGGGAATGAATGGCTT
CTTCAAGATTGTTCGTGGTAAGAACAACCTGGGCATTGAAGCCGATTGTGCTTTTATGGAACCGGACATCAGCGATGAGGAACTCGTATGGGAGGAGAAG
CCTATCTACGGAGGCTCGATCTTCGGGATTGTTCCATTTGAAGACACTGC