Description :
From Genome Similarity Track
Location :
scaffold_795:3534- 7440
Transcript NameFunction/comments
Pl_102368hypothetical protein PHYSODRAFT_333373

Sequence
3906 bases(100 bases per row)
CGTTTGAATAGTGCAAGCGTCTGGAGTCTGGATAGAGCACTGTGGAGCGTTTCCGGGGTCGCACTCGTCTCCGGATTCGCCATGGTCGCTGCAGATGTCA
CGACAGTAGCGGATGCCTCCTGCTTTACAGCGTGGCTTCGGCGCGACTTGGTTGGTGTGTTGTTCGAACTTTGCTGTTTAGCCCAGGCCCTCAACGCCGG
TAGAAACTTGTCGAGTGGCGTGTATTGGGTATTGTCACGGTGCTCGACGAACAAGAACGGCATCGGGTCTTCATTTGCACACTTCGTATCTTTGATCAAA
CTGCCGTCCGTGTGGTGTACGAACTCGGAATAGTTATAACACTTGTTACAGCAGTCACACTTTATGACTGGTGTTTTCTTTGGGAACCACGTGCATTTGC
CTGTTTTCATGATCCCTGAATTTCAGCGCAACAACGTCAGGTAACATTACGATCATTCATATCGAGCCATCTCCGTTGTCTTCACGCTGTACACGCACAG
CACTAACAAGCTCATCACCTGAAAGTTCAGGTTGCTCGGGCTCGCCAGTAGGTTCATACATAATACTAGATATCACTTTTTGTGGCGTCGTACGTTCATT
CCATACTGAGTCACCCTTCGGATGCTGTTCAAGAATTTCATCATCTTCAAGCTGTTGTATCTCCATATTTTGATCACATCCTGTCTTTGTTACTCCACTT
ACAGCCGTACGCGGTCGACAATGATCATTCACATCCATAGACACAGCGATTTCCTCGTTGAGCCCTACTTTTGATTCACGTGCACTCTCAATGGCTCTAT
CCGTTGTTTTTGTCACGACTACATCTTGTTCCATCTTCGGTCCTTGTCCTCCATCCTGCGAACGCGATATCCGTGCGTCAACAACTTGGTTGTCGGGTGT
AGCACTGATTCCTCGTGTGCGGCGACTACGAGATGACGAGTTTGACCGGCTTGGTGTTGGTACTGGCGCTTTAGCGCTACTGTTCTTCTTTTGTCCCTTT
TTCTCCTTACTACGTTGTTTCTCCAGTTCCATGTCGTTCATCATCTGCACCAACATTCGTTGACGATAGTAAATCAATTTTTCAGGTTGAGTGCACGTCG
GGCAGTCACAATCCCAAAGATATCCACCACTTTCATAGAAATCAATAAATGCAGCTTTGCACGACGCACAACGAAAGATTTTACCACGATGATCAGGTAC
TTCAAGCTGCAAGCGTTCCATCTGCTCCAAAATCGGCTTCTTCTCATCCACGAAAGGTTTGAATGCATGCAAGAAACATCCTGCATGATACACTCGACGA
CACGCATGACAATGCATCTGCACGCAAATATTCGTCACCTTTTTGCAGAACTCACAGTTGCGAGTGGTATCAGCTTCGATCTCCTTCACCAGATTCAATT
TCTTGGCCTTTTTCCCTCTCAACTCTGGACTTGTGGTTGTAAATGGTAGTGGTGGTAGATCAGTAATAATCGGTGAAGCTTCGATCACCGATGTAGCGTC
ATACACTGCAGCTTGTCGTCGTTTCTTGCCTCTTGCACTCTCCATCTCCAGTGACTTTTGCTTCGTGACTTTGGGTCGCTTGGCTGCTGGTTCCGCTTCA
GCCTCTGTTGTCCGTTTCTTGGAGTTTTGCTCCACTGGATCCACCAACACTGCAGATATCAACATTCCTAAAGTTCCTTCTTCTTCTTTAGCTTGTCGTG
CCATCCCAGCATTGGCCGCTGCAGCAGCAGCTCTTGATGGTCTTCTACTAAATGTATCCATGTTAGGAACGGTACCAAGTTTTGCAGGTTTTGATGTCTT
AAGATCACCAAGAGCATTAGCCACCACGACACCTAATGGAACGTCCTCTTCCTTAACTTGTTGCGCCATAACAACATTGGCTGCGATTGCTGCAGCTCTC
GGATGGCTAGTTCGAGTATTGTGACTATTGTCACCGTCTGACGATACTGCTACAGACTGGTTGGTAGCATCGGCTATTGCTACCGTCTCACTGTAGCCAT
GTTGAAATGTGTTTTGTTGCATCTCCTGGGTGGTTTTAGAGCTTGAAACTTCGTCTGCACCTGATCCTATGTCTTGTGAATGTAGTGTAGCGCTTGGATT
GGGCACTGGGTGCGTCGTTGTTGACGTAGAGGCCTCCGTCAGAGAGACATCGGCAGGTGTCATGAGGGTCAGTCAACTGTTGTATGATGGAGAAAAGCTC
TATATCATCGATTTCATTGGTCAAAATAATGATGCGATATGAGAGGACACAACATGGCTACATGTAATTATAAAATGTAGCCATATTTAGACCACTTCAA
CAAGAACTTGCTGTAGTAGTTAAGATGCACCCGAAGACTCCATCAACACCTAATGAACGGGGAAAAAGTCGTGGACGAAGTACTCGAGCGAGAATTTCAG
TCATGAAAGTTGCTTCGAGAGTGAAAACACCATTGACATCTTCTGCTACATCGGAGACCAATGTGTCAACCGACATTTTCAGTGCTGCAACGAGTTCTAG
TGTGGGTAGTCGTATGAATGAGGAACAAGGTAAATTCAAGGGTTTCAGTCGAGCAGCATATTCCATCATCAATATGCACAAATTGCAGAGTGAGTCAAAA
ACGGAAAATGTGGCAACACGTCCGGGACAAAAAGACCCGTGGGCAACAGTCATGACTAGTGTGGTGCATAAGGTCTCAAGACATAACGATATGGGTCTGG
GTCTTGGCCATAATGCAACGGGTGTTGTATCGGAGAAGAGAATTTCGCTTGCACAGATGCTTAAAAGTCGAGAAATGAAGAATTTAGTACAGCAAGCGCT
CGTAGCAAAACAACTTACTCGAAAGACAGCACCACCGGAGGAACAATCGAGTGTGATGACCCATTGGATTAAACTGTCCACACTACGTCGTAAGCAAAAT
AATCCGGAAGAAGATAGCTTCACAGGAGATAGTGGAGGACGAGTTGATAACAGAATAAACTACAATAGCGAAGAAGAAGACTATTCCGATATTGTGGAAG
ACCTCAATGGGGTGCATTCAGGCTTTGATCTCGATGACACTGCTAAGGGACATCAACTGTATGGACGCACACTCATATTAGAGGAGTCTTGTCGTCGTGC
TCTCGCTCAAGACTGTGAACAGCGGTCGCAGATGGATCTGCAGTCTCTCGGTGTCTGGTTCCAGACTACGAAACTCAAGATTACTACAGATTTCGAGCGC
TTGCAGCCATCCGAGCTAGATTTGCTGTGTCGACGTATGACCTGCGTGACATTTCACCCGGACGAAACCATTTTCCGCCAAGGTGATGAAGGTGACGCAC
TTTACATTGTTTTTAGTGGAACTGTGGAAGTTCGAGTTAGTCAACGTATTCTCGGTGAGGTGGTGGAAGTCACAGTTTGCGAACTTGGGAAGGGTGACTA
CTTCGGTGAGCGTTCCCTACTCAATAACGATGTACGCGCTGCAACGGTGCTATCGAAAACTTCCACTGAGCTCGTCAAGATTACGCGGAGTGACTACAAT
TTAATGCTGAAGAACGACCAGCTCGAGTTCCTCTCACGTATGCAAATCGCAAACGGAATTGGTGTTCAACGTCCAGTGCAGCGATCGCAGCGTGATTATA
TCAAGGTGCTCACCAAAAAGAAACATGCACGCACTAAGGCTGACATTGATATGCTTAGCGAGTATCTTCAGACACTCAAATTTTTCCGAAGTTTGCCGAA
ATCCTTCGTGCGTGAGCTCTGTGTCGTCGTTGATTTCCTCACACTGCCTGGTGGTGCTTGTGTGTTTCGCGAGGGTGAGATTGGAGACTTGTTTTACATC
ATATTTACTGGTTCCGTGGACGTTAATATCAACTCGAAAGACTTTAAAGGCAATATGCAGATGACCAAACTCGTCAATTTGACCGAGGGCTCGCATTTCG
GCGAGT