Description :
From Genome Similarity Track
Location :
Scaffold_1271:3534- 4873
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_1271-abinit-gene-0.6Reverse transcriptase

Sequence
1339 bases(100 bases per row)
TCCATTGAATAACACGTTCACACTTTCTTCGGCTGGCTAACTTTCCGACTTTCTCCTTGGCTCTTCGACTCCTTCCTCTCGCCGATGTGTTGCTCTTATC
TCGCGAGCACCCATACACCAGCTTCGTCTTCCTGAACTCACTACACATTCACCTCTCCAGGCTCAGCNNNNNNNNNNCTTTATTGAATGACACGTTCACA
CTCTCTTCGGCTGGATAACTTTCCGTCTTTCTCCTTGGCTCTTCGACTTCTTCCTCTCGCCGATGTGTTGCTCTTATCTCGCGAGCACCCATCCACCGAC
CTCGTCTTCCTGAACTCTCTACCCATTCACCTCTCCAGGCTCAGCCGGTGCCTCCCACCGGTTGTGGCCCCACCACAGACAGCTGCCAAGCCAGCGACTT
GGTCAGCCCGGGTGGTGGCCACGCCGCTCTTCGGCGGCACGGTATTCGACAGCACCTAGTAGCACCGTGGATACCCGCACCGCCAGCCGAGCTCACTCTT
CTTCCTCCCTTTCGCCTTCTCCTCCTTGCTCGTCCGCAGCCATAGCTGCCAACCGTCCCTCTGCTCGCAACATCTGCTCGTACTCATCCAGTAGACTCGG
CGCGTTCATGTCGTCCTCTGACACCCAGGTTGGGTCGGTATTGCTGACCCACTTTACGTGGTAATCGCGGACCTGGCGACCGAGCCGCGCCGATCGATAG
TCGCGATGGCCAAGAATCGCCTCCACCTCGTACTCCCCTTGATCGTGGTCTGGCTCGAGCGAGTCCTCTGGCAGCAACGCCTCATCGAANNNNNNNNNNT
CGCGCCGCTCTTCGGCAGCGCAGCGCTCAATTGCAACCCAGATGGCATAACGAACAGCCACGCCGCCAGCCGAGCTCACTCTTCCTCCTTCTCTCCACCT
TCTTCCCCTTGCTCATCCGTGGCCATCGCAGCCAGCCGACCTTGAGCCCTCATCTTCCGCTCGTACTCGTCCAGCAGGCTTGGCGCGTTCATGTCGTCTT
CCGACACCCAGCTCGGATCCGTGTAGCCGACCCACTTGACATGATAATCTCGAACCTGTCGGCCGAGTTGTGCCAAACGGTAGTCACGGTGGCCGATGAT
CGCCTCCACTTCATACTCGCCTTGATCGTGATCGGGCTCGAGAGAGTCTTCCGGCAGTAGAGCCTCGTCAAAGTCGAAGCGTTGATCAGCTGGGACCTCC
AAGGCTTCAGCTGGCCTCGGCTCGAAGTCTCGCCATATCTTTAGTCGTGACACGTGTACGACCGGAAAGACTCGATAAGCGGTTCCCTCAATCTCGAGCC
GGACGAGATGCTCTGCCGATCGCTCTAGAACCCGAAAGG