Description :
From Genome Similarity Track
Location :
Scaffold_138:35337- 36919
Sequence
1582 bases(100 bases per row)
CGTCGTCCCGCTCGAGATCCTTCTCCGTGGCCTTTCGACTTCGGCCACCTGCTCACTGTGGGTACACACCGCCTCGAACTTTAATGCCACTCCACTCTCA
CTCGCTTGAGGTCACCACTGCTGTGTCTGCGTGACGCAGCTCACACCTACTACTGTGAACTAGACCGTATGTGACTTACGCTAGCAATACCAAGTTCTAG
TTATATTGGTTAGGTCGATAAACGGTCAGTTGACCCTGTCCTGGAGATCTCGTACGGCTTCGGCCAGTGAAGATCACGTAGAACTTTGGCTAGTGCAGAT
CCCGTATGGCTTTGGAGAGATCATGTACGTCTTTGGAGAGAGGAGGTTCCGTAGGACCTTGGCCGGTGAAGATCACGTACACTAAGCGCGAAGCACTGTA
CTTGTGCCTTCATCGACCAGCACCAATTACCGTGTCGACACCTGGTTGCTGTCCTTCACAGTCGAGGAACACTCGATACGGTGTTCTCGTACTGTAGCTA
GATGTACTTGATTGCAACCTATGCCAAAGCCTCCTCGGGGGCGGCTGTGCAGCTACCTTTAGATCAGAAAATTGGGCTCGATGGCGAGACGACCCCGCCG
ATTCTAGCCGCTAAGCGTGGAAGTCCGCAGACATAGCAATTCAGGAGCAATGGGGAGGACGGACCTGGCCCAAGATACCGTTGTGGGCAGTGTGAACATG
TTGGACACAACAAACGAACATGTACAGAGCGGAAGGTTGGCTCGTAGAGCACGTGGAGACGGTAGCCTCGCTCGCTGATACTAAGTACCATCGCAGTGAC
ACCAGAGCAAAAGGACGACTGAATCGGTATGCGAGATTTGTCGATATCACATGTTTATCGGTACGGAGTAAgcaggcatcttcaaactgggcgttGCTAA
CATAAAAGGACgaaacgcccagtttgaTATGCCCAGGAATCCTCATTTTGAACCATGAAAATGGcctggaggagctcgtgttgaagGCCCCATCAACAGA
TATGGGACTGCTGCAGTCCTCCATGCACTCGATGCAgtcttgcagccttcacaaGTGGTTCACACCTCACAAAAGCCGTAGCACATGGCAATCGAACCAG
CAATGTCAGCCTAAACTCGACGGTTTACTTTGGCATACAGTAATTTACCAGCTacccagcaccacctctCCTCTCCCGGTGACCACAATGAAGAGACCAC
CAGCGAAAGAAAAAAATCGAACAAAGGGCTGCTACAAGCCGCCCCACCAAGAAGGGCGATGCATCAACGACTCTCTCGTATTTTCTCCTCCCAAGGCAAG
TGTTGCATGCCAGAAATGGCTTCCGAAGTACGAGAtcgatcttggcctgcacCCATTCAACTTCCGAGACGGCGGTTGTAAAAGGCTCTCTGTAAGTTCT
GTGACATCTTCGgtcgagaggaagaaggccaaaACCCGCTCGGTATTTCGACGTTTGGATTGCTTgtgagcacgaagaagcaacAGAAGAACTGTTAGCA
ATTCATCGGGAGCTATAGGAAGCAGAGTGACTTATAGTGGCGTTAGGTAGGGCTAAATGACATTAGTTATTGGTTTGCTTGA