Description :
From Genome Similarity Track
Location :
Scaffold_281:35335- 37342
Sequence
2007 bases(100 bases per row)
GGGGTATTAAGCACGAGATTGAACCTGCCACTTTTTATTGTGTGACCAGGCAGTGGCCGTTTTCGAAGGAATATTACAATGACCATTTCTTCGACACGAA
GTCTATGGTGGGATGTGTATGTAAGATCATGTCGACCCAATTTGGTCCCACGTTTCGTGGGCGTAAGGCAACAGGCGGTTGGCGCATACTTCATGAGTAC
AATACCAATGTACACGGCCACTCTCCATAGGAAAACACCGATCTCGCGGAAATTTGTCCTATATTATTCAATAGGAAATTCAACTGTGTTTTCCGCATTG
GTCATCAAGGATTGATACTACCAGGGTACTCATGGATGATACAGATGTAGCCAAGACGATAGTTGGCACCCCAAGCGGTATGCTNNNNNNNNNNAGTGTC
TAATGAGGCCGAAAGGGTTCAAAACGCACCTGCAACATTCAGGCGGGTTGTAGCTCATCTTATGTATCCTCATCATGCCTACGCATCCCATTAATGTGAC
TATTTTTCCATACTAAAACCGAGGAAGGAATAAGCTAAAGATTGAGTTGCACAAGAGTCATTTATACGCTTTGTTTCAGACTACAAGAAACGCCCAACTG
TAATCTCACGTGCAGAAATTCGTATTTGAGATCCCCATACAGCTGTACTCGTCTGCATCGAGGTAAAAATGGTGTAAGAGCAGACCAGGAAAAGGTTAGT
GTTACAAAGAAATGTCCAGTCCCACGACAAGTGAAGAACCTGCGTCGATTCCTTGAGCTTGCTATTAACGTGCACAATTACAGCAAGAATTATGCAGAGC
GAACCAAACCAGTTTATGAACTCCATGAAAAGTATGCAAGGGTAATTGGTCAAGGCTCAAGTAGATCCTTTAATTCAGCAAAGCAATCACTTTGTAGAAT
ATCCGGTCTTGGCACGACAAACGCGAATAATTCCTTTAGTTTCGCCATAGGCTGTGCGGTTAATTTCTCCATCGGCTGTGCACTTATGCAAACAGATGAC
GACGGCTTTGACTGCATCATCCAGTAATATTCCCATATTTTAAATACCATAGAGCTGAATGGCCCCGTGCGTGACAAGGAGCTGATTCAAGTTTCGTGTG
CACCTATTGAGCACCGAGCATTTTGTACTTTACAAGTATCACGCATCATTGAGAACCACAATTAAATTATCGCACCTATCGCCTAGTATGGCGAGATGGC
TCACATAATTATGAATTTAGCTTTTGAGTTGGATACAATCCGGGGAAGGCGAATGTCTTAGCTGGCGAGATATCGCACACACCAGACTTCAAGGAACGAC
ACCATGAAGACATATTACGTATTAAAGCACGTGTTGATTAAATTTTATTGTAATATCTTCGCGTCGTACATGTGACAAATAAACTGGTCTCTGATATATA
GTTACAGTGATGGCCTGCTATGGCATTATCGATCACTATGGTATCCGTTGAGAATCTATACCTCCATGACGCAAATCTCAAACAGAAGATTCTCTTCGAT
CTTCATTATACATCATCAAGTGGTCATTTGGACGTAAGAAGACATTCTTACGAGTGCAGATGATCTTTGGTGGTCATATATTTATTGGTAAGTATATACG
ATCATGCGAAGAATGTCAGCGCGTAAGGCCTACATCCTCTAAAGAGCGCCACCAAAGCCACTGTCGATATCAACTGATTGTTGGACGTCAGCCAGTTTGT
ATTTCATGTTAGGAATGCTGGCCAAACATAAAGGCAAGACTAGGATTGTAATCTTTATCGACAGACTGAGCATGATAGTGTACTTAGCACCATGAATCAT
CAAGAACATAGACAAGGTGGTAGCCTCCTTTCTCCTGGATGAAGTGTATCAACTTAACAGAATTTTCGAGTTCATTTGTTTCGGACCAGAATCCGCATTT
ACGTTAAGGTTTTGACTTCATTATTTTGAGCTGCTTGGTAGCAATTTTCACAAGTCTATCGCCGATCATATACAAACTGATGTCCAGGCCGATGGATCCA
ATCGCGT