Description :
From Genome Similarity Track
Location :
scaffold_11:353325- 357805
Transcript NameFunction/comments
Plaha_PHALS_10717zinc finger bed domain-containing protein 1-like

Sequence
4480 bases(100 bases per row)
TTTTTACCAAATCCAGCCTATCAGAGACGAGGAGCAAGCGTAGCTCCTTGATCACAGTGTAGGACAGCTGGACATTCCACGTGCTGGCACTGCGAGGGGC
AGAATCGATTATCATCACGGATAATCTGCTTAATCGACTAGATATTATGCCACCGGTATTTAAAGAAGAGGCGGTACGCAAAAAGAAGCTTACGAGTGTC
GTGTGGGAAACCTTTACACCCATTTCAAGTAGTGGATTGCGTGACGGCCTTGTTGACTCAGCCAAGTGCTCAATTTGCAGCAAGATCTTCAGTACGAGGC
ATGGCACATCGTCGATGATGCGACATGCTAGGCGACATAACGAATTCCCAAATGGCACGCCCACGGGCAAGAAGGGCAAGAAGAGCGCTAATGGATCATT
GGTTAATGGAAATGGAACAGGTAAGAAAGTAGGAGCTCATAGGAAAGAAGCAGTCGTGATACAGCTTGATGAACATACAGCAGGTACTAATTCAACGAAG
TTTGCTGATCGATTATTGTGGAAGTTAATGCGTGGAATTGCTTCGTGGTGCGCCCAGGTTTGAAGCGTCAGCGGATGCGAAATCTGAGTAGTGCGCTGAT
TGAGTGGATTGTGGAAGACCAAAAGGACCTGGGTGTGGTGCAGAACGAAAAGTTTTTGGACGTACTGGCTTCCGCAGGAATCAAGCCGATACTCCCACCA
GTAGATAGTTTGCAAAAAGCTATCGAACGAAAATATTACGATTTGTTCACGCGAGTGGGGGAATATATAAATCGTTCGGCGGTTGGACGCGTCACATTCT
CGTGTGATACGTGGTCTGGATCTGTGAATAAAGGATATATGGCCATTTATTTGCACTGGATTAATGCTGAGTGGGAGTATAAAACTATTCAAATTGGTTT
GGAAGGGTGTCCACAGGACTTTAATGCATACTTTTTGTCAGACATGCTATTTAATGTGCTTCAGAATAACTGGGGACTGGGTAATAAGTTGTTGTGCGGA
GTCACACCCTTGAGTAACGAGTCGGGAGTTGGCATGGGCTTTTTGCGTGAGAAAATAAAGTCAATTATAGGATTTCATAGTAGTGCACCGGACTGGAATG
TGACGTGCCTGGGCCATCTAATTCATACGGGCGTACTGGCGGCACTGAAGGAGATTCGTCACGAGATCGTTAAGCTTCGTTCGTTATTGTCACTTCTTAA
GTCTACATCCGAAAGTCAGGAGCATTTTGCGCTACGTACAACTGATGTGGGGCTGCCTGAGTATCCAGATCAGCTGCCTAATTTAGATTCACCTAAAAAT
TGGAAGACAACTGTTGCAATGATTTTGGAAAGCGCCAAGATTAAGGACACAATTAACGCCTTGTATGGAGATCCTACGCACAATATGAACATTTTCTTGT
TGGAAGAGATTGAGTGGGATTTGCTGGTATGGGTAGCTACGTTTCTTCAAAAATGCATGCAAATGGCGACTTGTCAAAGCGACCAGAAGCATATCTCGCT
GAGCACCTCCATTAATGTTTGTAAGGCGATTGTCGGGCTTTGTGAAAGCACTTCGGCATCAGCCTCTAATTTTACGGCAAGCGCCTTCAACAAGATACAA
ACAGTTTGCTTAAAAGTGAAAGCTAGTCTTGAGTCATACCATACGGAGCACTCATCACCGTATTTTCGGCTTGCCAAGATTTTAGATCCGCGCTTTTCCA
ATGAGTGCGTGGACAAAGCAGCcaaaaaaacgtttttgcGGGAAATGTTGCGTACAAGTGTGTATGATGTACTGTCAGACACACGATTAGACGACGAGCA
AGCAAGACACGATGCATCGGCGGCTTACACAACGTTTGAAAAGTTGTTAGATATTGGAGAGGGTATACCAGAGTACTCGATCGACGGTGACGAAGTAGAT
CGATTCTTTGATGCGACACTCTTTCGCGACAAGCGGTCAGATCCATTTTTATGGTGGAAGTCGAATGAAACGCGCTTTCCTTCTCTAGCAAAGCTCGCCC
GGGATATCTTGTCGATCCCAGCGACTGCTGTACCAAGTGGTACTGTTTTTACGCGAGCAAACTACGCTCGCCCGCTGAATGCGGAAATCATGGAGACCAA
CAAACTGTTTAAGTTCAATGAGCTTGCTCGAGCATGGCAAATCGAGCGCCAGAACTTCGGCCGCAAGCGACGTCGCGACTCTTTTGACTATTTGGATCCC
CCTTTGGAGCCTCCAATCAAATTGGCGCCATATGAAGAAAGTATTTAGGTAATAAAGAACGCGTCATCATTAAACTGTTTTTCTTGCTGCTGCCCGAAAA
TGTCATAAACTTTACAAAAGTAGACTGTAGGCGACAGGGTCAATCATGTATACACCTCTGTCCTTATTCTTAAACAGCTTCATTAGTAAAGATATTCAGA
AACTTGTACGTGTCGTCTAAAGAAATCTAGCAGCAACGTTTATGCATGAATAGCGCGAAAGAAACAATAAGCCTTAGCCATGCTGAGGAAGAAATGAAAG
ATCTCTAAGCTGTTCAGCATTACGTGAGGATGCATCTGCGCTTTGCATGCCTTCTTCTATCTCGAATGAGAGGTACGAAAGTCGGGCTCTTCTACCGGAA
CGTCCGAAGAACCCATACGGGGAACCATTGAGTCCCAGTAGGCGCTTCGCGACCTATTAGGAAAGAGCTGGGGTCTATTGTACCTATTCTAGGTCGTGCT
CAATAAATATCAGCCATAAAGAAAGCAACTCTGTCTAAGGGAGGTGGTGTTGTTGGTTTTAGTAATGACATTTTGGGCTTTGTGAAGCTGTGAAAAGTCC
TCCTGATAGATTTGCAATCACGTACGATGCGCGACTTTTAAATGCAGTAGACACTGCCACTCAATCAAATACGGATACAATATATTCGTGCGATTTGCGA
CTGGTATACTGGTAACGATGTCAAAGATTACGTTGAACTCTCAAGTATCTTTAACGACTCTGGCAACGTAAAGAGTTGTCGAGTACTGGACTCCAATTTT
GTTGATAATCTCATCCTATATATGGcgtggctggaacgccaCGTGTCACGGGTTCGTATGGAGGGTGGGAACTTAGTTGCCACGCATCGTTCTTCTAGTG
GAGCTTTTTGCAAGTCATGGAAACACCTTTGTCAGAAGACTGAAGCGAGTTTCATGCATCGACAAGCCTCCTGATAACTTCTgtttaacggggttacacg
tgctgttgtaagaaagggcgggtcgcacaatctacATGCATAGgagtgtattacacagttattGTAAATGCACAGtaaccgtaacaagaagccaccacgt
ggcaatCTTGcaagtagtaatgcatattactatattaattaggttttactatataaattaggTATCACGttattaatcaggaaaacctaaggtctTAGTt
tttggcggctctgccgcaactaagaCTGTTAAATAGTGAagacgctgcgaaaaacGTTTTcagcgacgcgattcacgcgctcattCTACCCATGATGGCC
CGCAGTTGACAtagccaacttggtgcccaccaccctgaagattgcagACCAAAATTTCTCAGTAAGCGctggtctctatcagaaacaattgactccggga
gtcaatactgtcgtaagacacgatcgacgaacagcgtcactgtacccacaccgtcaatGATGTCcgacactgccgcaagatgagccatcttgctcaaacg
gtccacaaagaccacgacacccgtgttgcccgctgagtccttcggcaggccaaacacaaagtccaaactcatggactgccaacaaacGGAGGGAgccggc
aaactggccagcggcggcCATGTATTCGGGTAAGGCTTCACCCTTtgtcacgtctcacacgtgcacatacatgtgctcgtccatttgtacagcttgagcc
accaatagtgacaGCTCACCAAGCTGTACgacttctcacgaccgagatgaccactgagtggggtgtcgtggcctcatagaggatacggtacttaggatac
ggtacttcatCGTGAAgatccacaattcgtggcgtatccttcAAaccggtgctataatacagcaattcacCATTCAATGGATATCGGTGCTACCGTGCgg
acgcagtcgcgacgataaCTTcgtgtccgagtttccaaatatccttgctcctgagagcctgtagcagcgccacGCACATAGCACCACCCGCGTACACGGC
GCACATGAGcgagctcataatccggtctgcgtgacaacgcatcggccAAAGCACTCcgctttcctggctaatagtttacctcgaagttataatcTGCGAA
TAAGCAGAGCTGCccggccatcctctgcgagaggtgaggcgactgaggtGCAGTACGTatatgtgtagatcacaaacggttttgagccaagcaatTGCAC
CCTGaagttgacaagtgcatattcatcgcaagtaattctttGTCGAAGATTAGGCTGTTCCTCTCCACAGTCTTAAGTtg