Description :
From Genome Similarity Track
Location :
Scaffold_198:3533- 10591
Transcript NameFunction/comments
Physo_144557reverse transcriptase
Physo_144558Retrovirus-related Pol polyprotein from transposon TNT 1-94

Sequence
7058 bases(100 bases per row)
GATGTGGCGATGGAGTCCGTGAGGTCGCGTCCCTCGACGAGGACCCCGACGATCTGTTTGACTTGGATGTCGGGACGCCGAGAGCCGCGGCCGTAGTCTC
AACCGCGACAGCCGGTGTCGGGATTACGCGCCTCTCGGCTTCATCGGAGCTGAAGGACTTCTCGGGACGAGATGCCGGAGAAGAAAAGGCTAGGCTGTGG
CTCAACCGTCTGATGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGGT
ATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTCCGGGTGCAGTACTGCGGCAAGGGCGTGTCAATGGCCAGTCGCTA
CCACCATGCGGCTCAGCGCTCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCGCGGGCATGAGGGCCAACATCCCATACGCCGAGGGCACG
ACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACTCGCCTCGCGTCTCACGCGGATGGAGGTCGCCGACT
CCGTGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTGGATTGATTCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGAC
CCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGTCGGACGAGTACGACTCGGAACGCGAAAGTCGCGACAGCGACGATCGCCAGTAC
GACCAAGACGAGGAGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGGCAGGCCCCGCCGGGAGAGTCGGCGCGTCGCAACTTTCATCTCGACGACTCGG
GACGCGATCGTCCGCATTGTCGCCACCGTGGTTTTCGTCGCGATGCTGAGGGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGTAAGCACCC
GACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTT
GACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGGTGTTAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGT
TTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGGGAGCCCGACTTCCCTGAATGATAATACATGTGAATCCAACCTGGAACGTACC
ACACGAGGACGCGCGCCGCACGACGGACGACGAGTTTGCACGTGAACCACCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAA
CATTATGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGGAAGCTGAACAACTGCCGTGTTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCA
TCCTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCTGATTGACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGG
GAGAACCAGAGTCAAGATTACCTTTGCTGGGAACTTGGTGCCTGTGGGTCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCC
AGCTGGAGTGCGCATCGACACTGCGGATGGCACGGCGTTCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATG
CACCCGGTCAACGTCAAGGCGCCTGTGAGACTCGAACCAGGGGACACGCATGAAATCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTAGCAC
GGACAGAGTCGTGGGTGACTACCTTTGTCAAGGGGAGAGTCGGAAGGAAGGCTTACCTACATGCCACAAACATCGGAGACGCACCGACCCTCGGTGCACA
TGAAACGCTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCGGAGCCGTGGGTTCGTCGGACTGGGCTCCCCTCGGTACCATCAGTGGCAGAACTTGGCG
TACGATGCGACGCACGACGCGGAAGAGAGCTGGATCTCAGCCGAGCCCGACGGGCCGATGACGGATCGTCCCTCATACCCGACGCCTAAAGCCATTTTGC
GCCCGGAGCCGAGACAACTCGGGACGCGACGCGCCATGACCCCAGTGTTGACGGCTGTCGCGGAAGCGCCGAAGGGAAGTGGGGTAGAGGTGCCGCCCGA
CGACCACAAGTCGGATGCGGATGAAGAGACGGTGGAAGGCGAACCCGATGTGCCTCCGACTGTGGGTGGAAACGCTGCGATGGAGGAATCGCCGGAGTCG
GAATTCACCGAGCCAAAACTCGACAAGGCGAAACCTGATGAGCAGGAGGAAGAGGACACAGTCCTCATTTACGAGGGGTCGACCTCTTCGCAGAGGATCT
TGAGTCTGAGATGGCAGTGCTGCCGGGCCTCTCGCTGACCGCCGAGGTGAAGATCGAGGACTTGAAGGTCGGCATGCCAACTGGACTCCCGCCCGAAGAA
GCCGCGAGACAAGAAACGCGGCTAAACCAAATCATCTGGAAGCGACGGAAGTGGTTGATCGGCAAGGGTAACGCTTTGCCGCCAGCCGCCCTGGGGGTGG
TCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGAACAACGCGCCCGGAAAATCCCACCACAGTTCAGAGAGAAGGTTGCCGACCTGATCAAGGGGCT
GCTAAGCGCGAGGATGATCCAGAAGTCGACGTCACCATGGGAGTCGCCCATTGTCGTGATTATAAAGAAGAACGGCGTCGATATCCGGCTCTGCATTGAC
TACATGCTCATCAATGGGCTGACGCAGCTGATGGTTTACCCCATGCCGCTCATCAACGACTTGCTCGAAGATTTAGACAAGTATCGGTGGTACTGCTCCC
TCGACATGGCGAGTGGCTTCTGGGTCGTCCGCATGACAGACCGGGCCCGGCGCATCTCAGCCTTCATCACGCCGATGGCCTGTACGAGTGGCTGCGTATG
CCGTTCGACCTGTGCAACGCGCCGCAGATTTACCTACGCTTGATCGACAACGCGTTTTACGGGTTCCTGAAGCTGTCTCCGGATGGCAGCACTCGGGACG
TCTTCGAAGACGGCGAACCGGTGAACCCAGGTATTCACTCTGTTCTGGGGCAGAGGTCGTACGTCGACGACATCCTTATCGGGGGCACGTCGTGGGACGA
CCTGTGCGAGAAGGTCGAACGCTTACTGGATGTCTGCAAGCAGTGACACTTGTCCATCAGCGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGTCGACTAC
CTAGGCCATCGAGTCTCAGGACTCGGTCTAGAGGCGAAGTCGAAGAATCTGGAGTCGCTGACGGCACTCGAGTTCCTGCGCACGCTCAAGAGCCTGCAAT
CGTTCTTGGGTAGTCTCAATTACTACCACCGGATCATTGCAAACTTTGCGGTGTACGCAGCCACGCTGTATTCGCTGACGGAGACCGATTTCGACGAGTA
CATCACGCGTCCAGAGGTCCGCGAACAAGAGAAGTGGACCAACGCGAAGCGCGCCTTCGACGCACTCAAGGCGAAACTCGCCGAGACCTCAATGCTGATG
CACTTCGACCGCGAATTGAGAACCCGTCGTTATCGTGTACGTCAGCGACTGGGCCATCTCAGGGGTGCTCACGCAGGTCCACGACGATGCATACATGCCT
GTGAAGTTCACCAGTCTCACGCTGAAGCCCAACGAGCTGAACTATGACATCGTCGAAATAGAGATCTTGGCCCTGTTGCGCGTCTTGAATGAGTGCTACA
CGATGCTAGCAGGGAGACCGGTCCGTGTCTTGACACGTCACACGACGCTCGCCTGGTTGTTCCGGTCCAAGGGACTACAGGGGGACTATCACAGGGGCCG
CGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAGGGGAGAAGAAGAACTTCTCGGCGCGCTGACCGCGAGCATTACACCGCGAGCCTTCGT
CGACGCGGCGCTAGAAGAGATCGCCCCACGGAAACGGGCGCCCAGGATTGTAGTCATTCCAGTCCCCGACGTGGCGCGCGACGAGGTCTTGCACGTCTTG
AGCTTCGACGGATCGGCTAAGGCGAAGCGAGAAGGCGGAGGATACAGAGCCGTCATTTGGCAGCTGTCGAACTGGGAGATCGTGCGCGCCGCGTCGGGAT
ATGCGACGGATCTCACGGTCAACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAGCTCGACGACGTCACTCGACTCGTCGTATG
CGGAGACGCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCACCAGGGCTGAAGCTGCTACGACAAAAGGCGCGAAACGCACTCCAG
GCATGGCCGCGCCACGGAGTCTTTCACGTACGACGAGACTAGAACACGAGAGCTGACATACTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGCCGCAACG
CGCACAGCCCCGGGGAGATTCAAGATCTGAAGACGTTGAACCACTTGGAAGAAGTCATCCGGCCACGGGCATCGAGTCCCGAGATGGCGTCTCCAGCCAA
CCTCGACGCGAAAAATCTCGACGCGGAAAATTGCGACGAGAAAACGCGCGGCGCAGATGGCCCCGTCGAGAAGGCCATGGACGCGGGACGCGGGGAGGAA
CACGTCCTCGCGGTGACGAAGCGCTCGGCTGCCGCACGCACGACAACTCGTAGGGGCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTACAACGACTGC
GCCTGGACCGCATCCGCGTCGCCCAGGACGAAGCGGTCTGGATCGTCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGT
GAAGAACTGCCAAAAGCTTGCGCCTCAGTACGAAGAGGGCGAAGGCGGGCGGCTCTACTACCAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTG
ATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTATCACGCAAGCCTGGAAGGCGGACACCAGGGTATTGGCCGCACGTACC
AACGCGTGAGGCGCCACTTCCATTGGCCCGGGATCTTCAGATGCGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACGGAAAAGGGTCGGCCGAC
CATCCAGGGCGAGTCGCCGGGCAACATCGTCGCAACGTACCCGTTCCAGGTCGTTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAAC
ATAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATACGTCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGG
CGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCACACTCATGGGTCA
GAGACAGCGAGCGACGCTTGCTTATCGTCCCCAAGCCAACGGGGCTGCAGAACGGATGGTGCAGACGGTTACAAGAGCGATCAAGACGTACATCGCAGAC
GTCGACCAACGCGACTGGGACGAATACGCCGAGTGTCTTACCTTCGCGCTAAACACGTCGCATGACCGGACGAGGAATGAAACCCCGTTCTTCTTAGTGC
ACGGCTGGGATCCTCGGTCGACGCTGGAAGCGACGCTGGCCGTCGGGAACACGTCGACCCGGGACGCCGAGGCGAGGCGGTGGAGGCTCCGTATCCAGCG
ACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTTGAAGAGAGAGCGCGTCGACAAACTGAAAACGCGACGCGACATGAGATC
GCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAACTCGCGCACATGTGGCACGGACCCTTCCGCGTCGCCGATC
TGGTCAGCGCGTTCGCAGTGCGCCTCGAGACGACGGGTACGCCCTATCAGCTGTACCCCGCCGTCCACATCTCCAAGCTGAAGCCCGTCCTGGAATTCCC
GTCGCGACCCGCGACGCAGCTGACGGTGCCGGCCGAGGAGCGCTTCGACTTCGACGAGGAGCTCTTGCCGGAGGCCAGCTGGGAGGCCACGCGCGAACTG
GATGACGACGTTTTCGAAGTCGAGAAGCTCGTGAACGTGCGCGAGGGCCGTGCAACCCGGTACGGTCGTACGCGACGCGAGTTCGAAGTCAAGTAGAAGG
AGTACCGCGGGTCGACGAGCTCGACCTCAACTGCGGCGGGCCCATGTACGACTTCCTGCGCGAGCGCACTTGACGCAACCGGTTCGAGGCGATGCAGTCG
CACGAGAACGGGGAGGCGGCGGATCCTAGTGGGTGAGCGCCCACGGGTGCGACTAAGTCGGCAGGGGGGCTGCCGACGGGAGGACTGGTGGGAAGTCTCG
ACTCTGGGAATGGCCGGAGCGAGGGATTGGATGAGGGAAGTGAAGAGGACCAGCCTGTTGCTGAAGATGGGACGGCGGAGGGCCGTCTCATAAAAGATGT
GGAGAAGTGGAAAGAAACAAGGGAAAGGATCAAGGCTACGTGTTGAAGTTACGGCTACAACAACTAAACGCGACGGACTGCAACGATGGGCCAAGACTCA
AACCTGCTGGACAAACTTACCTGCAAGACGCGGCACATGGAAGGCTGGGTGATCGCGCGTCACTCGGCAGCGTACGTTGGCGTCCATCTCGGCCACAGTG
AGCGGCGTCCGATAGAACCGGCGCCAGGGCTCCTGCGCGTCGATGTCGTCGAGCGCGGCTTGCAACGTCGCGTGCTGGAGGCCTGGATACCACCGTCCGA
TCGACGTGTGCGCGGGCGGAAAGTGAAGCACCATTGGGTCCAGCAAGAGGTCCATGTC