Description :
From Genome Similarity Track
Location :
scaffold_700:3533- 8336
Transcript NameFunction/comments
g9923.t1hypothetical protein
g9924.t1hypothetical protein

Sequence
4803 bases(100 bases per row)
GATCTTGCTCGCTACGCTCCCGAGCTGATCACCCGGGTCAACATAAAGAAGTTGTACGCCACGGCACCTTGGGACGTGTTAGTCGCTCGGGCTCCTGCGC
CTCTCTCCTTCCAGCCGTCGCGATCTCCTGATCTTGCCGCGATCTTGAGCTGGTACGAGGCGTTCGAGGCCACGCACATTCAGGCGATCTGGGAGTGCAC
ACACTCCTTCCCGATCACCAACGAGATGAAGAAGTCGGATCCCTGGTTCGCCAACTTCGTAAGAATCGTGGATCTCACGCTGGCGAGAAGTACCGAGTTC
TACAGGAGCGGGTTTTCCAGCGGATGCGTCAGACTGGATGCTGTGATATCGATCTTTGGCTGGATCCTCGATTCGTGCAGTTCCCCGTGTCGACGGAAGA
CACGACGTGGTTTCCCGGCCGCGAAGCTGCCACCGCTGGGCTGGATCCTCCGCAAGATCTCTCGGACGCGTTGGACGACTGCGATCGCGTGGACGCTTGG
CGAAGCCACTTTCGTTTCGAGCCACGTCTCCATCCGAGCCTTGGTATCAATCGACTAGGACTCAAGTTCACGCCGCTACCGTAGGACGAGTAGCTTCCGC
CGATAGCTTCTGCATATCGTAACTTCCAATTCCACTCTTATTCTTTTCATGATCACTCTTGTCCATGTTCGATAGATCCAGCTCAGGATCCGGCTTCATT
CATCCCAACCCCACTTGTTTGTAATTTTTGAAAATATAAACACACATCCACCCGACAACCAAGTTGTCGGATGGCAAACCACTGTCACTTGACTTGCATC
ATCCTGCAGATCCCTAGTTCACTAGCCACACCATCGGCCGCCCCGAAGGTGTGATCCACCACCTCACTCTTCCTCATGCGACCGCATCGCCTGGAACCGG
TTCCGCTTGCTTCGGCCCTGGAGAAACACGTACAACAGCGCTCCGCAGTTCAGATCAACTTCGTCGACCCAGGTGGGATCCTCGTATCCCTTCCAGGACA
CTTGGAACTCTCGCCGGATCCCACCATATCGCGTCGGTCGTCCGGTCCGCACGTCCACGATCCGTTCGACCTCGAATTCATCGTCTTCCAGTTCACGATC
CCAGCTGTCCTCGGGCAAAAGCGCCTCGTCAAAGTCCAGGCGGTCCGCTTCATCGACTGTCAGTCGGATCCCAGATCGATCGGGAAAGATACTGACCGGT
CTTTAGCTTAGAGATGTGCACCACGGGGAAGAGGTGGTAATCCGTTCCCGCTACTTCCAATCGCACCGCGTACTCGCTCACCATCTCCGCAACACGGAAT
GGACCGTGCCAGCTTCTTCGCGTATCCTTCCTTGACCCTGTCTAGGAAGAGCCACACTTGGGATCCGACCTCGATAGTGTGCAGCGTCGCCACCTCGTTG
TTACGGTCGGCGCGATCCGCAATGGCATGCTTCAACCGGTCGTTCGCCTCTGCTCGTGCTTGCTGGTAGTGCCGTTGGATCCGATATCTCCACCGACGTG
GGTCCACATCGCGATGTCCGGTATTCCCCAAAGACAGCGTAGCCTCCAGCGTAGTCTTGGGATCCCATCTGTGAGCCAGGTAGAAGGGCGTGTCGCCCCT
GGTCCTATCTTGCGCAGTATTCAGTGCGAATGTGAAGCGTTCAGCGTACTCATCCCAATCTCTCTGGTCGGGATCCTGGACATAAATTTTGATGGCTCGC
GTGATCGTCTGTACCATGCGCTCAGCTGATCCGTTCGACTGGGGTCGGTAGGCCATGGTCGCCCTTTGGCGCTGGCCCAGGATCCTGTTGAATGCGCGAA
AGAAGTCGGACATAAACCCTGGCTCGCGATCGTGTCGGATCACCTAGCTGGCTCCGAAGCGTCGGAACACGCAGGCTTCATACGATTCAGCAACCGCTTG
GGCCGTCCTCGAGTCGTTGGCGCTTGCGATCACGTACCCGGTAAAGAGATCCACCCACACGAGAAGCTCAGTGTTCCCCTTCATCGACTTAGGTAGCGAA
GGGATATGGTCCATGGCTATGACTTGGAAAGGGTAGGTGGCTTGAATGTTGCCTGGCGACACTCCTCTAATAGTTGGTCGCCCCTTGCCCGTCTCGCAGT
CAACGCATTCACCGATGAACTTCTGCACAGATCTGAAGAGTCCTCTCCAGTAGAAGTGATCCTTGATCCTCTGGTAAGTACGTTCGATCCCCTGGTGGCC
ACCTTCCAAGCTCACATCGTAGTGATGTAACAGGTCCGCTTGCAGCGTCTCCGAACCCACCAGGCGCAGCAATCCGTCGCGATCCGCGTCCGCTTTGCTG
GAGGGGGGGGGCAGTAGAGCAGCAGCTCGGAGTCGTCCAGCTCGAAGTTGTCCGCAAGCAAGCGGCAAGCCTTGGCTTCCGCACCGCTAAGGTCTGTTAA
CTGGCCTCTTAGAGACACTTTCAGGTTGGCGATCCATACCTCCTCGTCCTGCGCCTGCTGGACCCGCTCGATTCGCAACCGATGGACAGCTTCTTCGTCT
AGCACTTTGGGCCGTCCTTCTCTGGCTTGCCTCCTGGTCGTGACTGCATGGATCTTCGCCACGGATCCTTCGGATCCTGGGATCAGGATCTCATCCAGCC
TGTTCAGAGTGACCTGATCTTCCAAGTCCGACTCCGCTTCGACCACGATTCCACTCTCCCGTTGGAGCGCCGTGCTAGCTAGGCTGTCGGCACTGGCGTT
CCACGCTCTCTTGACATGCAGTAGGCCATGATCCGGCCATGTCCGCAGCTTAGTCAACGCCCTCTGTCGCAGCAGCATCAGCGCCGGCGCTTTGCAATCG
ATCTCTATACGCATCTGTCAGATCACCAGGTTGGAGTCCCGACAGATGTTGAGGCGTTCCTTGGTAAGATCCTCCAGCAACTCGAAACATAGCAGGAGTC
CATTGTACTCGGCCTCATTAACTGTCATAGTCTCTGCGTAACCTGATGCAGCCTTCACCACAGTCCACTCAGGTAACCTCCAGACAACCGCACTATACGC
GCCTCCGCCTCGCTTGACTCGGGCGGATCCATCGAAACTGGCAACCAGTAGCTCCTCGTCGGACCGTACGGTCCGCACAGGCATCTGGATCGTTCGTCGT
GGTTCCCTCCGGGGAGCAATATTGACTAGCGCCTTGTCTACCTCGGATCGGGGCGTAATACTCGCCGCGAGCGTCCCCAGGATCTCGTCCTCGCCCTTCG
TACACTTAGTGATCTCTAGAGTCCAGGGCGACAGCAGCGCAGCCCACTGTCCCAAGCGTCCTTGCAATCCCGAAGAGCGGAACAGCCACGCCAGGGTGGA
GTGTCGAGTTAGGATCCGGATATGTCTGCCCACTAACATAGAATAGCCGAGATCCAACATCCGCAATAGAGCCAACACCTTCTCCACGATCCCATAATTC
AACTCGTTCTGGTTCAAGGATCGACTTACGAACATAACCGGCAGGTAAACACCCTCGTGATCCTGCGTCAGCGACGCCGATATAGCCCACTCGCTAGCGT
ACAACACAATCACCGGATCCTTCGCGGGGTCGAAGTGACGGAGCGTCGGCGTCGTCGCGATCTTACTCTTGAGTGCGGTGAACGCAGCTGTAGCTCGGAT
CCACTTGTCATGCCCGTCTTCCGGATCCTCGTTCGCCAGGATCCTATCCTTGGATCTCAACTCCGCGAAGTCCACCTCGCGCAATTCGTACAGCACCGAC
GCATAGATCGCCATGTCTTCAATGAATCTAGCGTAGTAGTCCAGGCTGCCCAAAAACGACTGCATCGCTCGCAATGATCTCAGGAAAGGTAGATCCACCA
GGGCCTGCAGATCTTTCGGGTGTGCCTCCAGGCCTTTGTAAGAGACTCGATGGCCGAGATACTCCACCTTCCGTAGGCCCCAGAAACTCTTCGCCACGCT
GATAGACAGGTTCCACTTGTCGCGCGCTTCCAGCAGCTGATGCACTCGCTCACACAAGTGATCCCAGGATCCCGCAGTAACCAGGATGTCATCGATATAG
GATCGGCGCCCCAAGACTGAGGACTGACCACTAACCTCAGGAATCCCTTCGATGAAGAGATCTGCCACGGATCCTGGCTCGGAAGCAGGTGGGATCGGCA
AGAAGCCATAGAGAACATTGTCTAGCAGCCGCTGGTAGATCTGCGGAGCTTTCTTCAGCCCGAAGGGCATGCGGTTCCACTCGAAAAGATCAAACGGAGT
GATGAAAGCTGAGATCGCTCGCGCGCGGTCCGTCATAGTCACCACTCACCATATCCAAGGAACAGTACCACAAGATCGCGTCGAGATCCTCTAACAAGTC
TTTGATCAACGGCATAGGGTAGATCATCAATCGTGTTAGGCTGTTGACCAACCTGTAATCAATACACAGTCTGATGTCCACGCCATTTTTCTTGATGATC
ACCACGATGGGCGACGCCCACGGTGACGTAGATACTTGGATGATCTTGGCCTGCAGCAATCCTTTGATAAGATCCGAGAACTTCTCGCGATACTGGGGCG
GCACCTTGCGCACTCGCTGGGCGATTGGCTTCGCGTCGCCGACGTCGATGTCGCACACCGCCCCAACCGCTGCGGGGGGCAGGGCATTGCCCATGCCGAT
CAGCAGGTGCTAGTACTTCCAGATCTCTTCCGCCAGTCGCTGGATCTCCCCCGGAGTGTTGGTCGCCGGATCTCCCACTTGCAAGTCTTCGATCTTCACC
TCGATCGTCGTGGCCGTAACCTCGGGCAACACTGCCAACTCCTTCTCGAGATCTTCTGCGTGTAGATCGCCACTCTCGTGCAGATACACTGCGTCGTCCT
CCG