Description :
From Genome Similarity Track
Location :
Scaffold_31:353208- 359408
Sequence
6200 bases(100 bases per row)
CCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAACCATGCAGGGTCCAAGGTGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCG
ACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCAAG
TATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACAAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGCACCAGA
GCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGACAGGCGTGGTCGCGATCCTGTTCCTCA
GTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCAAGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTC
ACGGAGTGGATCCAGCTCCTGTGTTAGGTCCTCCTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTCGTTGGATT
TTCATCTGGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAACCGACTGT
AGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCTAATCC
CTCCTTTGGAAACTCGATGGCCCAAGTAATCCACCTTTGCGCATCCCCCCATAGCTCTTAACCACACTGATAGAGAGATTCCCCTATTAGTACACGCCTC
CAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCA
GGATCCCCTGGTTCCCCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGG
CGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATAT
TGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTGCTTTATCCAAATCTTCCAACAGCTCATTG
ATCAGAGGCATTGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTA
CCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCAC
CTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGTGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGC
AAATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCGG
TGGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTT
TGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCT
GTCGGACCCAGCCGGTCCTCTAACGAGTCTAAACCCGACGGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAA
AGCTTGGATCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCATCGACCCTGCGTTATCTAAGGGCCGACTCTG
GGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCC
ACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTCTGTAGCGGC
GGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCT
GACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGACTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACC
CACTTCAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCC
GTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCAGCTGGCACCATGAAATCCATCCCAAGGAT
GGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTAT
ACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCAC
CACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACG
GGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTG
GTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACT
CGTCCACTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGA
TGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTT
CCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACA
CCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGG
GATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGAGTACGGTATCCCCCGGTCGAGAGT
TGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCC
TGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATTCGACCGCCGCCTTCTTCTGG
CGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCA
ACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAG
ATATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGC
AAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCAT
CCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTACTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGA
TATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCG
TCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCATGGAGCACTTGCACTTGTGGCACGGGCG
CTCTCATACCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCC
ACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTG
TCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACCGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGA
GGGTCCTAAAGTCATGCGTCGTGGTTCAGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGAC
GACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGA
AGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTCACTGCCACCAACTTGTTCGCCGTTTTCGTTGG
TGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCGTAGAGCTTGGTGGCGATAC
ACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTT
TCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGCATCTGCAAATGCATACCGTTTCGCCTTCACTTT
CCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCC
ACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCT
CTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCG
GGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAAC
TTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGG
GGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCG
TGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGCTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG