Description :
From Genome Similarity Track
Location :
Scaffold_1723:3532- 5010
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1723-fgenesh-gene-0.0Serine racemase

Sequence
1478 bases(100 bases per row)
CATCATGCGCGAGTGGATGGTGACGCCGAGCGTGGTCGTGGACGAGAAACGTCTGCTGCTCAACGTGCAGCGCATGCAGCAGCTGGCGAACGAGCACCAC
GTGCAGCTGCGCCCGCACGTCAAGACCCACAAGACCATCGAGATCGCGGCGCTGCAGCTGCAGGCGGGGGCGTGCGGCATCACGGTCGCAAAACCTTCCG
AGGCGCTCAAGTTCCTGCACAGTGAGCTCAAGGCGCTCAAGAGTATCCTCGTCGCGTACCCGGTGGTGCAAACTAGCAAGGTGAGCAAGTTGCTCGTCGC
GGCGCAGCAGTTCGACATGGAAGTGCGCATGACGGTGGACAGCGTGAACGGCATCGACGCGGTCGAGAAGGCAGCCAACTCATGTGACTACAAGGTCAAG
GTGCTCCTCCACATCGACGTGGGCTACCACCGCGTGGGTCTAGAGGATGGCGACCCGCGAATTCTCGAGTTCGCTAAGCGTATCGAGAAGTCCCTAAACC
TCGAGTTCACGGGGCTGCTCTCTCATGCCGGTAAAATGTTGTGCACGAGATTGTTGTGGCTTTGGCTGTGATTGAAAGTGCAGCTAAATCATTGTTACGC
TTGTACCACGCTGTGAAAGGCCACGCGTATTCTAGCAAGACTGTGGAGGAGTGCACTGCGATCGCGGAAACGGAGCGAAGCATCCTCATTCACATCAAGA
GCATGCTGGAGGAGGTGTGAACTGCACTGTGTGCGGTGGTCATGCTGCTCTTGTACCTGTTTCTGATATACGACGATCATATTGGTTTGAATTGTAGAAC
GGCATTGCGGTTCCAGTCGTGTCGGTCGGCAGCACTCTGACCGAGCCAGCGCGCAAGAGCTTTGTGGGGATCACTGAGATCCGTCCTGGGAACTACGTGT
TCCTTGACCGCACGCCGGTGAACATTGGCTTGTTCTCGATCAAGGACGTGTCGCTAGGCGTGCTAGTCACAGTCGTGAGCTCCAACAAGTACTACTTCAT
CGTCGACGCAGGATCAAAAGTGCTCAGCTCTGACGCGTACGTGCCAGTTTGAGCTTTGGAGTTGGACTCTTTGCTTGAATGAGCTGATTTGATCTCTCAT
GGTGTTGTTTGTTTGTTTGCTGTTCATATGTTTCTTACTCCCTAAGACCGCGTGCGGTTGAGAGTGGTGCTTTTGGGACCAGCGGATACGGACTGGCATT
TTATGAGAAAGATTTCGAGCACCTGGACAAAGAGCCCAAGCAAAACAAGTCAACGCTGAGCGACGGGCGTGAGATCACGTGCTTTGAAGTGGCGAAGCTC
TCGGAAGAGCACGGCTGGATCAAGCAGGTCGAGGGCATCCCGCCTCCTCCCATCGGACAGCGCATGATCATCCTTCCCAACCACTCTTGCGTCATCGCGA
ACCTCGCAGACAACCTCTACATCCAGGGAGAGCACGCCAAGAGCTGGAAAGTTGTTGCACGAGGCTGCAGCCAGTAGT