Description :
From Genome Similarity Track
Location :
contig_1:35316- 38918
Transcript NameFunction/comments
g6.t1hypothetical protein
g7.t1XP_009523320.1 hypothetical protein PHYSODRAFT_259378 [Phytophthora sojae

Sequence
3602 bases(100 bases per row)
GAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGG
TTACGACAGATCTATATGATCGGATACGCTTGGCATATCGAGATGATGAGAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCC
TGCATGGCTAACGCCCCGCCAACGTGCCCGACTCCGTCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATA
GTCGTCCCCAACGAAGAGGATCTGAAGTATGACATCCTTCAGGAGGCGCACGATGTGCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGG
TCTCCCAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGTCACGTATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTC
GGCTCCTTTGCAGAGCCTGCCAGTCCCAGAAGACTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGC
GTCCTGGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGACTCCGTCACCGGGGAACAGACTGCAAGGCTGTTCCTGGATGGCG
TCTTCCGCTATCATGGCCTCCCTGAGACTATTATCTCTGACCGTGACCCAAGGTTCACGTCTGCGTTTTGGAAAACGCTGTTCCACTTGCTTGGAACACA
CTGCTCATGTCCACGGCCGACCGCCCGCAAACAGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTC
CCGGCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGTTCTCTCCGTTCTACCTCAACGGGCTCCA
GAACCCCCTGGTGCCACTCACTCTCCGTGGTGACACCGTGGCTTCGGTCGTAAGTGGGGGAGAGGCGCGGAAAGCTCTTTCCTCCCAGGTGTCAGAAGTG
ACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTAATGTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAAC
AAAAGGAGTACTCTGACCGACATGGAAGAGGAACTTAAACGTGTTCAAAGTGGACGAGTTAGTACTAGGAACCTACCACTAAACTCGGTCAGTTCCGTGC
TCAGCAATAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTGAGCAGGCATGGTTCCGCCTACACGATCGACTTGCCTAAGTCGATGACAACCCA
CCCGACGTTTTATGTGGGTCGTCTGAAGCGCTACCACGACACTCAGGCTTCTGATCCCCCGCAGGAAGCGAAAGGGGATTATGAGGTGGCGAGATCACCA
CCTCGAACCGAGCGCTCGCCTCCCGCTGTGGCGACCGCCACGCGGAAGCCGGCACAGGGGACTGGTCGTAGGCGTAAGCCTGCGGCCTCGAAGACGCCCC
GCCGTACGGGTAGGAGCCGTAGTACGGCTGGGAGTACGCATAGGACTGCGTCTCCCGATAGCCCGGATAGCTCGGCCGGTTCTGGAGCTCAGAACGGAGG
TGAGCCAAGACAGTCGACGTCGTACGACGACACACGACGATCGACCCGGGAGTGGAGATCCCCACACTCCTGACTCAATCGGTCCACGTCCCCACGAAGG
AGGGAAAGAGACCCCGGCTTGCCCGACTGAGCGGCAGCCTGCCCACCAGGGCCGAGACCCAACGCGATCTCCAGAGTGTACACTCGATCACGGAGATCGT
GGATCTCCTGCTGCTGAAGCAGCACGGACTGATCGGGAGATCGCGCCGACGATCTCGGAGCCTCACGCCGTGGCGGAGCCTCGTACGCATAGTCGAGCAA
GGCCTCCACCGGCCCTCCTCGATCGTAATGGGGAAACCCACTACCACGTGGAGCGCGTGCTCCGTGAGCGGCGCCGCCAAAGGAAGCGCCAGCTCTTGGT
GAAGTGGCGAGGGTATCCCTCGTCACAGAACTCATGGGAGCCGATCGAGCGGCTCCAGGCTGACTGCCCGAAGGCTGTCGCGATCTGGGAACAGAAGCAG
CGACAGCTTCGTAAGTAGTCTGCGGCTTCTTAGCCGACGGACGGGGTACGGTGGCAGACGCATGAACACCGTACCCGCGCTCATTTCGAGCGCCGGACTG
AGCTCTACGCTTAAGTCCTTCCATCTTGGAGTACAGCATCCGCTTACTCACGAGGTGGGCAAACCGAATCCGGAGGTCGCGCTGATCGAGGATTCGATGC
AGCAAGCGATCCTCCTTGAGCTCATCGAGCTCCTGCGCGGAATGCCCACGCAGGCCAACCCACCGCCAGAACAGGTCCTCTTGGGCCACGGTGTAAGTGT
TCTCGGGTTGGACCCAAGGGTAACCCCACACCGGGTGGAGACCACCCCTGTTCTCACCCTTCTTGCGAATGATGGTGAACTTCTTGAGCGGCATCCGATG
CGGAGCCAGGAGAACGCACCGAGCGGCCTCAATATCCTCGGTGAACAAGTCCACCTTTTGAATCAAGTCGCGCTCGTACGCGCCTCGGGAGGTGGGGCCT
CCAATGCGGCCACAAGGGGCGACGAGCCTCTCAAGGAACAACGGAGAACCCGTGTTCTCATCGGGCGGGAAGTAGCCCTGGTGTGCTTGGGCTCCCTCTC
TCCCGAAGCACCCCCGCCAGGAGTTGGCTGCGGCGCAGGAGGCGGGAGGCACTGGCGCGTTCGGTCCTCCTGGAGGCGTTCCTGCTGCTCGTCGAGCGCA
TTAGCGACCTCCTCCGGGACATGTACCTGTCCCTCTTCATCCTCCGAGTTTGACTCCGAGGAGTCAAACAGGGACTTGATAACATCAAGCCCTCTAGTCC
GGCCCTTGGGAGGGGACCGAGAAGCGATTCGCTTCTTCGACCCGGCCTCTTTGGCCTTGCGTCACGGGCTCGCTGGAGACCCTCGCCGAGCGTCAAGCGC
TTGGCTGGCGACGCTGCCTTAGCGTCGCCGTCCTTCTGGCCACCCGCGGTGCTGTCATTCGTGGACACAGTGTCCGCAGGAGACTTGGAAACGTTGTCCC
ATCCCATTCAGGTCCCCATGGACCGAGGACACGTCCTCAGACTCGCCTTTGTGACTTGGCGCGTCACCTTCGTCGTGTGAGACTGCTCCAGGAGAGGAGC
AGTGCTCAAGGTCGCTCGGCGACCCAGGACTTCGGTCCCGATGTACAAACCGAGGGTTTGGACGGTCGTCCGGTGGTACATCGGGCGAACCACGGCGTCA
CGAGCGCGTGTTCGCAGACGCGGATACGGATGCGTCGCCAGGCGAATTAATCGCCTGGGAAGCCGCATCAACGGCTTCCCCCAACGCGGAGGCCTTGCCG
CGAGGCTTGGCCGATTTAGACTTCAGGGCTTAGTCCTGGACGCTTTCGCGTCGCGAGGTGTCTTCCTCTGAGGCATCGTGCCAGGCCGACGTGGAGGCCA
GG