Description :
From Genome Similarity Track
Location :
Scaffold_975:3530- 8413
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_975-snap-gene-0.7Choline-phosphate cytidylyltransferase B
Pytir_DAOMBR486fgenesh_masked-pir_contig_975-abinit-gene-0.21Armc6 protein
Pytir_DAOMBR486maker-pir_contig_975-fgenesh-gene-0.4Ubiquitin carrier protein

Sequence
4883 bases(100 bases per row)
CTATGAGCCGTACCGCAAGACGCTGGTGGAGGGCGAACCGGGGACGCTCACGGGACGCCCGCTGCGGCTCTACGCGGACGGCATCTTCGACCTCTTCCAC
TTTGGCCACGCCAAGGCGCTGCAGCAGTGCAAGGAGGCGTACCCAAACACGTTCCTGATCGTGGGTTGCTGCGGTGACGAGATCACGCACAAGCTCAAGG
GACGTACGGTGATGACCGACAAGGAGCGCTACGAGTCGCTGCGCCACTGCAAGTGGGTGGACGAGGTGGTGGAGGATGCGCCGTGGGTGATCACGGATGA
GTTCATCGAGAAGCACGAGATCGACTACGTCTGCCACGACGCGCTGCCGTACACCCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGGCTTCTTCCACAAACTCGTGGGCAAAGCAGAGGACATCCAGACGGGCTTTCTGGATCTGTTCCGTC
GCGAAGGATCACTGGTACGCTGTTGTGATCATAACCGCTTGGTGGTGATGGATTTTATAAATGGTGCTGACGAATTGTTGTCCTCTTGTGAACACAGCGC
ACGTCGGTGCGTGAGCAGCGGCAGCAGATCAAGCGCCGCCTCTCGATGTCGCACCCTGAAAACGCGCCAAGTAAAGAGGAGCAAGCTGGTCGACAATCGC
TGTAGCAGAATAGATGGAGAACGGCGGATGCGAATAGAGAGGGAGACAATCCAATGATCGATAGATGCGTCGTGTATAGAGAATGGTTCTTTAGGCTGCT
TTTACAATCAACAAACGAATGCACTGTCAGGGAGTCAGTCTTGAAGCCACATACACACGCAACAAGGAGATATAAAAGAAGTTTCTTCGTACCTAATATC
GTAGAAGCAATGGACGCATAGAGACACCAGCGAGATACACGCTACGCAGTGCTATATCTACATCTTCTGCAATGCGTTGACCGAGTGTTGCACTTTGGAT
GCTGATGTCGCTGCATAAATTAGAGCATGAAGAGCTATACAAATGCCACAAACCAAATCGACATGTTGTTCAGCAGTGTGAGAGCCGTGTGCACATGCAA
TCTACAATAATGTGTACGGCTATATGAAGGCGAGCCTTACCACTGCGGAAATGCTTCTGCGCTTGGCGCAGATCATTCGGCGGCAGCGAGCTGAACCACA
TGATCGTCGAGTTATGCAGGTCGAGTTGCTGTGTTTGCTGCTGTGGCTGCTTCGATGTCACCACAGTCTCCTTATCACCATTGCTCTTTCCTTTTCGCTG
TGTCACTGCTGACGGTGCGTCCTTCTCTTCGTTCTTCGCACTCGCACCGTTTGGCGACGTCAACATCCAATGCATGTCGCTCTCAACGCCTTCCTCTTCT
TCACCTCCACCATCATTGCTAGTATTGCGCGCAGCTGCGACTGTCACCGCTTCAAAGTGCTCATGATACGACAAGTCGCTCAGTGCGTGCGCTGGAAGAT
ATCGTCTCGCCATCATCAACTTCAAGAAGCCCTATGATCGCAACAAGAAGAAGATAGATCATGTCAGCACAACCGCCCTAGCAAGCCTTAACACATAGCA
GTAGCACTGGCACCTGCTTGAGCTTCTCGCATGCGCGCTGGTGCTCGTTCAGATAGTCCTCGAGCGCGCAGACTCCACCCACAAGCAGCGCGTTCGCGTC
GTCGCCAATCTGCTTTTGCTTCTGCTTCTGCTCATCAACCTCCTTGGTCATCTTTGGCTTTCTTTCTGCGAGTGTGACCGATCCTGCAAAGGCAACCTGT
TTAGAAACGACCTGCAATTTAGACGCTGCGTGTTCTAAATGGATCTGTCGCTGAGGCACACAAGCTCGATGTTGCACCATGATCGTTTCGAACGTTTCTA
TCGTGGTGGAATGATTAAAGTGGCGCCTTCTTAATGCAAAATGTGTGTCATTATTTTCAAATTGACCGAGAGAAAGAGAGCCGCAGACAGATCCAAGCAA
GCGCAGCAGAGACGATGAAGAAGAAAGCGATGCAGCCGCAGCGCGCGCAGATCTCGCAGGAGACGTTCGACGAGGTCGTGAAGGAGAACATGGAGGAGTT
CGACATGGACCTGGAGGAAGCCACGCGCGACGCCGTGCAGCAGTTCGAGTCGCAGCGCGTCGACCTCTCCAACATCATCAAGCACGTCACGCTCGGAGAT
GACGGCACTGATGATAACGATGATGGTGGTGAAGGTGCCAAGCCTGTGAGCGTATTGGATCAGATCAAGAGCGCTATCAGTGAGCTCAGTACGCTGTCGA
AGAATCTTGTGGATGGCGAAGGTGCTGATGCGACTGCAGTTGTGTTAGCCAAGTTGGCACAGCTGCAAGAGCTCTGTGATAAAATCCCGGAAGCAAAAGT
GGTCGCTGGCCGCAACAACGCGATCGACACGCTGTTAGAGATCACCGACGCATCTGCTGCAAGTGGTACTGCGAATGCGACTGTGTTGGAGAAGGCGAGT
GCGCTGCTGGCGTTCCTGTGTGCAGACAACACTGACAACCAAGACTTTGTCGGTCAGGCGGGCATGGAGCGATTAGCAAACGTGCTGGGCAAGCTCCGTG
TGACGGCTACTGCCAGTACAGACAACGACGCTGAGTCAGTCTCCACATCAGCGGTAACTCGCGTGCTCAACCTCGTGCGCGTGGCTTGCGCAAAACATGA
ATCCAACAAGACCCACTTCACAAAAGCTCAGGGCATTGACGTGCTTTGTGAGCAACTCGCACTCGCGAAATTAGACGAATCGCTCTCCAAGCACGTCGCG
CTTGTGCTGCGCGTGCTCACAGTGAATGACGACCCGAAAGCGACTTTCTCGCAAGCCCAGGAGACGATCAAGCAGCTGGTCGCGAAAGATCTGGTCGCGT
ACATTATCGAGATCGTGCAGACTCACGGCGACAAGCCCGAGATGCTGAGCGTGTGGCTCATCGTGCTCAAGCAGCTCGCGATCACGGAGGAGAACTGCAA
GAAGATCTACGAGCTCCAGGGACTCGACTTGCTGCAGCAGGTCATGATCACGCACGAGAAGAACCTCACAGTCATGAAGCGCTGTATCACAGTGTTCCGC
AACGTCGCCGCGGCAGACGAGCTCAAGGAGTACATCATCAAGTCTGGCGGTGTCGAGCGTGTGTTGACAGGTATGCGCCTGCATTTGGGCGACCCGTCGA
TCCAGCAACATGCCTGCGCGACGCTCGCTGCGATCGCACTGCGTGCTCCAGAGAACAGTATTCATATCGTGAACCTGGGCGGCGCGCGCCAAATTGCGTT
TGCGATGCGCACACACCGCGACAACACGGGTGTGTTGCGTCAAGCGAGCTTGGCGATCCGCAACATGGTCGCGCGCTGCGTGGAGCTGCGACCGCGCATC
TTGGACGAAGACATTGAGCCGCTGTTGCGCGACGCGCAGAAGTACCGCGGCTGTGGCGACGAAGCGTACGCCGCGCTGCGCGACCTGGGCTGCGACATCC
AGCTCGCAGCGTTCGGCACGACCTCGACGAAGGCGCGCTTCAACCCTGTCAACATTGAGTCGAACCAGCTCTTAGACCGAGTCGACGAGGCTGCGGAAGC
ACCATTCGCCACGTAAAATTTAAATGCAGTTGAGCCATTCACTACTGTGCGACTTGAATTGGCATGGTGTCGTGGAGGCGAGGACAAGGGATGACTGACA
TGCGTTTGCGTTTGTGTGCATATATTCATCATATCTACTGCTTAGAAAATCACCCTACAAACTAATTGAGCTTGCGGTGACGCGTAGATAGACTTGATCC
CTCTTTCCGCATCAACCGTAGCCCCTTCCTTCCTTGGCGCTCCACCTGTAATGTAAAACTCTACCTGACAGCGCCATCTCACTTGCTCGCTTATGCTTCT
TCATCTTTTTCTTCACTACGTTTGGGTCGCTTTTGAAGCTGCTTCCGACGCGCTCAACATGTCAAAAATTTATCTTCCATGCCTCTTGTCTTTTTCTTTA
CTGAGCTGCTCGCGCCATCCGCCGTGCAGCTTCAAAAGCGTCTTTCCACACGATGATCGTTGTTTGTTGTGTGTATTTGTTGTTGTCCACTTTTTCTTGT
GATCGTGGGCATGCACGCTTACGAGATCGCAACCCAACTCTGCTCGACGATTTCGCGCACGCGACGATTGTACTCGCGGCGGTTTTCCTGGAAAAGGCGC
GCGGCCTCCGAGTTCGCCGGCGAGTTCGGGTTTGGGTCGCACAGCAGCGACTGAATCGACGTCAGGATCGCCGAGATATCGTAGATCGGTGACCATTGGT
TCTGCAGGATATCGAGACAGATCTGGCCGTCATTGTAGACTGCAAGCAACAGTCACATTCCCACAGATAATCACATTAGTTTGTACCCAGCATGTTCTCT
CCCAAATATATACAAGCAAGTGCATATGCAAAGCTCGATGGCGCTGGACGTACTGTTTGGATGGAACATCTTTGTGATAAATCGCACGGTCGGTGCTTTG
TTCGGGTAGTCTTCGCTGAACTCGAGCGTCAGGTTGAAAGTACCACCCTCCCACGGCGTGTCATCCGGTCTGCACAGCACACACGAAATAAAACACCACA
CGCGTCAGTATAAGCGCGCACGCATAGTAACATCCACATAATAGCCAACGACATACACAGCCACCACCGGCAATACAGCGCATATCCAATCCAGCGAGCA
GCTACACAAACTTCTGGGTGGATTTCATTCATTCAAGAGCTTCGAAAGAAAGACGTACCCAAAGATGACGGCTTGCCAGAGCATGATGTTGTTGTCCATC
GGCGCGCCGGAGACGCCTGACGGCGGGTCGTTCTGCAACTTGCGGAAGTCGCGCATGAGTCGTCTTCTCGCGGCGGTCGACAT