Description :
From Genome Similarity Track
Location :
scaffold_881:3530- 5016
Transcript NameFunction/comments
g10526.t1 conserved hypothetical protein

Sequence
1486 bases(100 bases per row)
TTTGTAGCTTTTCCAGTTTGAAGTTTGAAGTTTGTCATATTAGCTCGATCTTGGATCTAAATTCGTCTGTACAGCAATGGGAGGGACGTCGCTCTTTCGT
GTGGGGGACAACGTGGAGCTATGGCGTGTACTACTGCATCTGAGTGTACTGGTGGTTTGTCTGCTGCTTTTCGAACGTGCGCTTCACCTCCTTGAACACC
GCGCTGCCGTCTCCGCCAAGTACCAGCAGCTACTGAGCAAGGCGTATCGCGAGCTCATGATCCTCGGACTCATTGGTCTTGGGTTAAAATTGGTCAAGGA
AGTGCCGAGCGTCAATGGTAGCAGTGCTGCCATGACGGCCTTCCAGGTCGCAGATCTGACCATCTTCATACTGGCGTTGGCCCTCATCCTGCAGGCCGTT
TGTATCTTCCTTGTGCTGCTAAAGCACAACGTTCACGCAGACCGAGCCGAGCTACTTTCAACAGGAGACTTGGCTGAGACTGTGGCCTCCTCAGCTTTTG
GCTGGGGAGAAGGCACGCAGGAGCTGGTTCACTTACGTTTGTTGCGTCACTTTTTCCTCAAACGGTTCGAGCTCCCCGAGCTCTTCCCTTTTGCCAAGTA
CCTTCGCCAGGCACAAAACAACCAGATCACACACATGACCGACGTGAGTGCTCCAATGTGGCTACTGCTGCTGGTTGTGGCCTGGGTGCTGGAGAGAATC
ACAACAGCTTTAAATTATGGCGAACCAGCGCTGACAATGCGTCGTGGTCTTGTCCTGGTCTTGATCGGGTTCTCCTGGGCATTACTTCTGCTACACACCG
CTGTGCTCGTTTACTTCCGCTCGTGCGTTCATCAACTGCTCGAAGCTGCTGGGATGTCAGCGGATCACAACTCTTTAGTGAGGCACTTGAGGACCATCGC
GCACGAAGAAGCTCGAGCTTGGACACAGGAGGATGCTGGAAAGGCTCTTCTGGTTATGCAAAAGGTGCAAGAGTGGCACGAGTCACCAAGACAACCAAAT
CTAAACCAACGTCCCAAAAACAACAAGTACGCTATCAACTCGGAGGCGGCTCCTGTGATCGAAATGCGTTATTTTTCAAGAAAATCATGGCATTTCACGG
TTATGATGCTGCTGATGCTTAATGGGTTTTATCTGGCATTAGTAGTGCAGTGTGTGGTGTACCAGCTCGGAGTCGTCTACGCCGACTTGGGGATTCTGGA
AGTACTTGCGATTCCGATTCCGCTGGCCCTGAACACGGTCCTATTGCAGCCGCAGATATTCCGGAGCTTTGTCTTGGTGAGCAGTATCTTCCGTGTAGAT
GGGGTCACGCTGAGTGAAGTTGTGAATCACTTCCGTGAAATTGTAGAGCTACGCTCCGAGTTTGCCGTTTTATTGTGGGGGAATATGCAAGCCAAGAAAA
TATCCATGCGTGAGCTGCAGTTGGAACTACAAGCACGAGATTCAGATCATTCTGGTTCCATTGACGTGGAGAAGATGCGAGGCGTG