Description :
From Genome Similarity Track
Location :
Scaffold_181:35282- 38997
Transcript NameFunction/comments
Phyta_totarag5180conserved hypothetical protein
Phyta_totarag5181hypothetical protein PHYSODRAFT_248430

Sequence
3715 bases(100 bases per row)
CCTGTAGTAATGCGGTGGACAAGGCGACGTTAACGGGGACCAGTCGACTCCAGTCACTGCAAAGTTAGTGCAGAACGTCCGGCCACCACCGTCGACAGGG
GAAGCGCTGAGCTGAGACCTACCGCTACTCGAAGCCTCCAGCTGGCCGGAGACAGATGCTACTTTGGACTACTCCAACGGCGAGTGCAGAGCAAAGTGCT
TGCTGCAAGCCACCAAAATTCCAGGACTCTGATATCGAGTTGGCGAGTTGGCGAGTTGCCGCGGATGGGCTCCGCAAGATCGCCATCGAATATCTGAAAT
GACGCCGAAAAAGAAAATCTTATTCATGCTCTACGCTTTCCAGGCTCGTGATTGGGTCTGCGGGAAATTCGATGTTGAACTCGATTGTAGAACCCGCTTC
AGTTCAACCTTCAGTTCAACCAGGACTCGGCCGAGTGTCGCCGAGGAATTGGTTGCCGTCGGCGctgtaatacatgtatacggCGTGTGCACGTCCGGCA
TTGCCGAGCCATCCATGGGAGAGACGTCAACCTCTGCCATTTGTTATTGAATAGGGCTGGCTGTTTGATTTGCAGGCAGTTTAACGGGGCCCTGTAGCTA
ATGTTTTCGGGCCAGGACTGGGTTTACGTGTTACATCTGCATGGCGCAAAAGGGTAAATCCGCCGCGATGGAACTTTAGTGGTCGAGGCGGGCGGCAGTC
GATCTCCGAGTTCTGGAGTGGACAAAGCGCCTCTCCCCCGGGCAGGTTCcattctccaacttgctCTCGACCCAATCGGAATCGCTTTTTTGCAGGCGAT
TCGTTTCCCCTCGCAAAAAGCGCCACGAAGTTCCGTCGTTTCCCTTTCCGTTCACTCGCTCCACGCCGCCAGCGTGTCGAGAGCAAAAGAGCAAACGGGT
CGAGTCACGTCAACGAAACTGAgctccatcgccaccaactgCAAACAGCAAGCAAGCTCCAACCGCTCCGTCTCTCACCGGCGAAGGCTTTCGGCAACTT
GTTGCAAAGTCTCTTCGCTGGTACAATCCCAGCTCCGTTTCGCCCCTGAAAGACTCCGCACTCGTTAATTGGCTTTCCAAACGCCGCACTACTCCAACAG
ACACACACAACTGACGCACACAAGCAAAAGTGCGATCTGCCACGCTACGGTGCAACACACCAAAcaaaccaccaccagcaaattATTCTTTTTAAATCGA
AGCCGTCAGTCAGCCAACTCAGCAGCGATcacccaccaccacagcGATGCCACTTTCCATCTCGTTTTACCACAACAAACGCGGCGAAAACATCGCCAGC
TCTTACCAGagcgtggcgctgcacgacCGAGAGAAGGTGAAGCACAAAATGGCTCTGCCCTGCGAGTTCTACCGTAATATTTGGGGCCCcaccgacgaag
aagacgctgcgctgcgaCGTCGAGCCCGATCCAGcaggctcagcagctccCCCGCCTCGGCAATATCGCGGAGAttcaagaagcgcgtggcaACGGGCCC
CCTCGTTGACATTGCGCAGGTGGCACACGTGGTCACCACCATGTCCGACTTCCGAGCTGATTACGGCGAGGATTCCAAGAAGGTGAGGCTCGTGAACATT
TGGGACGACCGCAGTCTTGCGTTAGGCTTAGAACCAGAGTCCGGCTCCCGCAAGTCTTCGGACAACAGCGCGGGAAGCGAACGGGGCCCTTCCACTGCGG
ATACCGAGCCGGAAGAAATCATGTCGCCCATTTGCAGTCGAGCGGACAGGATCACAGAACTCAGCtgcgaagacagcgacgacgagctcagcagcttAGC
GTCGTCCGTGGTGAACCGACATCGGCCAGGGCAGCTGAAGCGAGCCAACACACCCGAGATTGTGCTCCCAcgcaccaagaagaacaatAGCAATGGACGT
GACAATGCCAAGCCGGACAGGAAGGAGCTGAACTTGAAAAACTTGCCAGTACCCCCTCCTTCGTCACACAATGGCAGCATCATATTTAGCGCCGTGTTCT
CGGAGCAGCGggactggagctggagcgcgaggTTCCTGTTGGGAATCCATGAGCCGATTCGTCACGCACTTTTCGTGATGGATCGGTTCTTGGAGCAGTC
TCAGAGTCAGTCCAAGCCTGAAGCTTCGCACACCTTGGCACTGGAGACTCACGTTACAGAATTCTTCCTCTGGTTTAAGACGTACTTTGTGGAGTATTTG
CAGTGTCAGCATGACGTCAAGGCTTCCGTGTTGCTGCCACTACTCAATCTGCCAGTGtcgaccaagcagcagattctggaTGTGTACCAGGATATATCGC
AAATGCTGGCGCAAATTCAGCAGTTGGAACGTGCTTTGTGTGTCAGCGGAGCTTGCAGTGCATCGTCATGGCTGCTACGGCTTCAGGTGTTGCAAACAGA
GATCAGACAGCTCAACCGCACGCTGCATGCGGCATTGAACATGGAGGAGACGACGTTGCACGCAGCTATGGGCGCTGCATTCACAGAGCGCGCATTTCAT
AGCCACATCATGCCTCGAGTATTCCGAGCTATCCGAGCCAAGCGTGTCGTGGTGCCATGGATCGTTGAGCGCAGCAAAATCTGGGGAGGAGAAACTGAGC
AGCTCAGTATTCAGGGTATGCTGCCCTTCTCGGCAAAGTTCATGTACCGCAAGGTTTGGCGACCGTATTTCATGAGCAACGTAGCGGTGGCGATGAAAAA
TCTGAACGAGTTTGTCAGCACTGCGGGCTCGAACAGCAGTGGTGCTAGTAGCACGTCGACTTACAGCGAACGCCACGGAGAAATGTGCTCTATCATGTGA
AGTGGTAACGACAGTCTTTCGTCTTCTCTAACTGAAAGCGCTACAGCTATTTATTATGGAGCAACATCTCAAGCGTATGTCGTGGCGTGACCTAAGCTAG
CAGAACGAAAGCCAGTACTCATCGTAATAAATGAAAATGCTTCCTAGATCCTTCAAAATCATGACTACAGCGTTTTGGTCTCAAGCTCTAGCTTGGCCAG
TTAACCATGACAATGCCAGCAATACAAGATCGTGGGTTGGCCAACTACTTCATGCTAATTGCCGATATCTGCCAAAAGCATCGTTACATCATATTGTCGA
ACGCAGTGGCGAGTCCCAACTTGGGACCCAAGGTTGAAGCGAaacgacgttgaagttgcaagGCAAACGCAATGATCGTTATTCGCTGTTGGTTTCAGGA
TCGATGCCATCGGTTTTCACGAGTCTCATTTGCAGCACCTCACTAACCAAAACAGCAGACGAATCAATATGACCGCTTACAGGAAGGTTCAGCCGAAGAA
CGTGTCGAACCTTGATCTCGAGCAACGAATTCCGCACAGTAAGTTGAACGACCAGGCCGAAGACAACACTTCGGAAACTGACGACGGCTTTCAACCATCC
TCAATCTATTCGGAAGTGCCTCAACTTGCATGGGAATGGATTTGCTGGTCTGGTGCCAAGACGTTCGACGGCATGGACTTCGCAGGCGAGGTGCTTGCGA
ATTTTCTTGGACTCAATCAGTCGAAGTACCAATGGATTCTCGACGCGCAAGAGcgtgaagaggaggaaaagcagcaacgtcaacttGAAAagcgccagcg
tcgtcaactccgtcttgagcagctttTGGAGGCAGAGCAGCGGAAGCTCCAGGAACTAGAGACCGGTGCGCTGGAGCAAGACTCCAAGTTGATAGAGACA
CCCAATACAGTTTAG