Description :
From Genome Similarity Track
Location :
Scaffold_624:3528- 5471
Sequence
1943 bases(100 bases per row)
TGGACCATTTTCCAGGAGTGTGTTATCCAATACCCGCGCGATTCCCATGTTGAGAGGTCGAGCTCCATCCTCACAGGCGATCGGGCGTATTCATCAATCT
TGTCACACTTGATATTAAAAAAAACCCAATGTAAAATCATTATGGATATTAGCGATCGGATCGATCCGATCGTTAATCTCTTATTTCTTCCGTTTTCCTT
CAACAAATGCATAAATGCAAAGCCTAGAATGCTCGGATCGTGCCAAATTCCAACCTGACGAGTGTCCTGGTTTAACATCTCCTCCACATTGGGGGAAACA
TTCCACCATGCTTTGTGGGCACGTACCACTTGCGGATCAAGTTGAAAGATTCTTCCATTGGGCATTTGCCACTCCCGTGCATTTGTCCGCATGCTGCACA
CACAAAGAAGCATTTGTCAGAGGGATGCCCTTTGCGACCACACTTCTGGCACGTCAATTTCTTCCAGCACCCTCGATCATTATGTCTGGTAGATCCACAA
TGGGTACACGACTTCGATCGTCCACCACGATCGTGTCCATTCCTTTCACTAGTGTTCTTCCGCCAGGTGAGGTGATCCTTGTCCGAATTTTCTTGGTCAG
GTGTAGTTGTCACGCAAACTTGACAATGATCCACGTCTTCATCGGATCCAATTGACTCTGATTCTGATCCGCTACTTTCGACTTTCTCGCGGATCGCTCG
CACCGCTCGAGCTGTCTTCGACGACCTTGGATTTGAAGACGTGGTCGTTCGCTGATGGAATTTGTTCAATCCCATCGACGCTTTTATCTGGCGATTCTCC
ATCCGTTGGCACTCATGTAGAGTTGTCTCCACCTCGTCAACATCCATCAATCGCAGTATAATAAGCCGTTTTGCTAGATCACAATCATCTAGCGTAGCAA
TGAAGTGGTCCACATGTTCGCGACGTGTGGCCAAGATAGCCAATCTTTACTCTTTGATTGCGATCTTGGCGTGCTTTGCCGCGAAATTGAGGCGATAAAA
GTATTCAAGCGGGGTTTCATCGGATCTCTTCCGTGCAAGATAATATTGCCTAGCCACAGGCACCCCTTGCCCTCCATACTAAATCATAAAACAATCCAGC
AATCGCTTCCACTTGTGTCGTATAGATGGAACAGTTGGTTGTACCAGTTTCGTTCTGGTCCTATCAACAAATCGCCGAACACTAAAATTTGCCTCGTCAG
GGAATCCACCACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN