Description :
From Genome Similarity Track
Location :
contig_99:35273- 42199
Sequence
6926 bases(100 bases per row)
GGCATGTGCTGTGGTTACGCTGTTGGCGGCGGCACGACTGAGAATTGGGCCGGACGCGGCGGCACGAGGTGTAGTTACGCTGTTGGCGGCGGCACGACCG
AGAATGGGGCCGGACGCGGCGGCATGAGCTGTGGTTACGCTGTTGGCGGCGGCACGAGGTGTAAGTTACTCTATAGACGGCGGCACGACCGAGAATTGGG
TCGGACGCGGCGGCATGAGCTGTAGTTACGCTGTTGGCGGCGGCACGACTGAGAATTGGGCCGGACGCGGCGGCACGAGGTGTAGTTACGCTGTTGGCGG
CGGCACGACCGAGAATGGGGCCGGACGCGGCGGCATGAGCTGTGGTTACGCTGTTGGCGGCGGCATGAGGTGTAGTTACTCTATAGACGGCGGCACGACC
GAGAATGGGGCCGGACGCGGCGGCATGAGCTGTGGTTACGTGTGACGCAGTTGCCGTCAGCGGCAGGTATTGCCGCAACTACAACCAATCTGGTTGAACA
ATAAATTTTCGTATGCATGTCTACCAATATCTGAATGGCGCAAGATATTCAAGGATAAGAACAAGAATCTGATACGTCCGATAATCATTAATTTGATTGG
TCTAAATCATCAAGATTTGATAATATCCAGTATGGGAACTGGATTTTTGATGAAACTACAACTACGTGGATATTTTAGACAAGATCATTGGTAGAACAGA
TAGCAGCTGAGATTAGAGAAGGATAGGCTTTAGGGTAGGACACTAGTGGTCTCAAGGACATCCGTAAAAGCAAACAGCTCAATCTCAATCACTTCTCAAT
TTGCTTTCAATAGCAACAACCCCTCCACCAACCTCGTCACCTGCCTACCCAAGGACCGCACGCCGGACACGCCAAGCAAGACCTTCCTCGGCGCAAGACT
GTTACATAGTAGCACTTGCCGTGTCAAGCTTCGATTCAAGCTTCGGTTCAAGTTCAAGAGTTCAAGGCTAGGGTACTTGTGGCCACATAGTGGGAAGCGA
GTATCCTGTGACTATTAGTGCGAGCCACATCGTGGGGAGCACTAGGTTGCGAAAGGGTTGTCTTTTAGCACGAACGTTACGTTCAGTGGCTAGTCGGTGT
GGTTGTGAACCAGTGTGGTTACTCGATTGGTACTCCTTCTGTGGGTCCGCGGTTTAGTGCTTTCACTTTGTGAATCCCTGTCCCGCCTCAGAAAACACGG
AGAATAACTTCCTTTCGGTATACCTACTTGGTCTTACTTGATCTACATCCATTGCTACTGCAACTGTTTCAGTGTGCATTGTTGCATGGGTAAACGAAAA
ACTCGCGAGCCCGAAGAACCGTTCGTCAACACCACTAAGGTCTTAACCGATCGCCATAAGGAGCTTGATAAGCTTCGAAAGGACCTGTGGTTAACGACGG
TAAAGCAACTTAAGGTTGTCAAACTCATCCGAAACGAAATTCCGGATTGTAAAAATTCAAGTGCGAGGAACGTCGTTCACGAATTTTCGGAACAGCTGAA
ACAGCTTATCGAGCGTACCCAAACGGTTTTGGAAGGAACATTCGACCACTCCGTCCAACTTTACAAGAAACGTAGACTGTAAATAAGAATTTAGACAGTT
CCGTTTTATTTTCAAAGGCTTTATTTTAGGGTTTCGGTAGTATATATAGTGACGGCGCTGAGAAGTCCGGTTGATATGACCCAAAGAAGAGGTCGTGCAA
CTGAGCGCCCGTCCCCGAACCCTAGACCTCGTCAACAGAGCAGAATGAGCTCTCCGAGTGACAATGAAGCCACACGCCCGACAACACGTTCCAGAACACG
CACGCAAGCACAACCGAATGGGGCTAGTGCCGATAATGAGGCAAATTCGGCCGCCCCCGCTGCAGCAGCTGCGCAATCAAGTCATGGACCCGATACGATG
TCCATGCAGCAGTTACTAGTGTATCTTACACAGCAGCAACAACAATATCAAGCCCAGGTGCAAGCCCAAATGCAAGCCCAAATGCAGCAGGCTAACGAGC
GTTTTGAATTCCTCGTTGCATCAAGAGGCGAACACAAGAAGAAGGACCCTCCTGTGTATGAAGGGAAGTACGGCGAAGACATTGAGCTATGGATCTTCGC
TACTGAACAGTACTATGCCAACAAGCGTCACATAATGGAAGCTGATTCGTCAGACTTTGTGACGCTAATCTCCAGTAACTTGGGCAAGTCCGTGTTGAAT
TGGTACCGTGCCTTTATCACGGATTGTGAGCGCATGAGCGTTCACCAAACATGGTCTCTGTTCAAGCGTCAACTGCGTACACGTTTCCGACCCAAGGACT
TCGAGTATGATCTTCGCGAGCGGATGTTTCACTTAAAACAAAAGGAAACAATCCACGAATATGTCTCTAAGTTCCAAGACTTGTTGTCTCAAACTGAATT
AGAGATAAGTGAACTAGAGAAGCGTTTCTTTTTCCAGAATGGACTACGGGAAGAAACCGCGAAGAAAATCAAAGAAGAAAGTCCGAGTACGCTTCAAGAC
GCTATGGAGATTGCCTCTAACTTCGAGTTTGCACATTACTCGGGTAAACCACCTCGCATTCCGTCCAAGTCATCGCAGGCACCGGCCGAATCCGGTAAAC
GTTCAATCAAGCCGACATCGCAGAAACCAAAGCGATTCGAGAAGAAGAAGAACAAGAATGATGACTGGACGAAAACAGCTACATGCAATAACTGTGGCAA
AGTTGGCCACATTTCCCCGCAATGTACCGCTCCAAAACGTAAGGAAGCAAATAGGTACATCAGCGGCGCACTGTATGCTATCTTGGAAGCCGAGGCTCAT
GCGTACAAAGAAACGGGTCAAGAGAGATCCGTCACCATTTTCATTGATAATGGATGCAGCTTAAATGGCGTATCTGAGGAATTGGTGAAAACGCTTGGGC
TGGAGGTAACCGAAGGCGAGTTGATGCAGGTCGACCTTGGTTATGACCAAGTGGTACACCGTCCGCGTCGAACCGTGGAGATGAGTCTGCAGCTACCAGG
TTTCCCATTGACGTCGGGAACCTTCCAAGTCATGCCCGTTCCAGAAAACAAGGATGTTATTCTGGGCATGATGTGGCTGCGAGAGCAAAACCCGGATATC
GACTGGAGTACAGGGCAGGTCACACCACGCATCAAGATGGAGGATGAGCAAGATGCTCAACTAAGACTGCCTAAGCAACGCCCAGCTAGAAGAGTCGCTG
GACAACGCAGATCTCGTATCGACCAAAGTCGCGAGATTTTCAACCACTATCGGCAGCATGGCCACAAAGGCCAATATGGCAAGACGCGACTTATTTCAGC
TCAACAATTTCTAAGAATGTTGCGTCATGACAAGGACATTGAAGCAATCTTTGTCATCAATCCGCATGACTCTGAGAAGGCAGAACGCTTTAAGAGTCAA
GGATGGGAGGCACTTAAGGATAATCCAGCGTATGATATACTACGCAAGTATGCGGATACTGTTTTTCGCACGGAACTTCCAAACGAGACGCCTCCTGTAC
GAGAAGGGATCGAACACGAAATCCTTCTCCAGCCTGGTACCACGCCTATTTCGGTGAAACAATGGCGCCAGAGCCCTGATCAGCGCATCACAATTCAAGA
TTGGACCAAAGAGATGGTTCAAGCGGGCATTATTCGACCAAGCACGTCTGCATTTTCCGCGCCGACGTTCTGTGTCAAGAAGCCTGTTGGATGGCGCATT
GTGCACGACTATCGTCAGCTAAATCTAGCGACAATTTTGCCGGCTATACCAATGCCGCGCAAGGAGGATACCTTTGATGCCATGGCGGGCAGTCATTGGT
TTTCGTGCATGGACCTACTGTGGGGTTACTACCAAGTTAAGCTACGTGAATCGGACATACCGTTTACAGCTTTTTCGACCCCTGATGGTCTATTTGAATA
CCTCGTTACTCCAATGGGACTCAGTGGTAGTCCCGGAACATTTAACCGTCTTTTACAGAAAGTCTTTAGGGACTTAAGAGACGTGATGAGGATCTATTTT
GACGACATCTACGTATTCACCCCGAGCGAAGATGTCGCAGAGCACCTTGAAGCTTTAGATCGTGTGCTCAAGCGATGTGAAGAACAGCAACTTTACATCA
AATTATCCAAGTGTCAGTTCTGTGTGGACGAGATTCCATGCCTAGGAGATTTCGTCGGACGAAAAGGAGTCCGAATGGATCCAGACAAGGTTCGCATCAT
CGCAGAATGGCCTGTTCCCAAGACCAAGAAGCAAATGGAGAGCTTCTTAGGAACTACGGTCTATGTGTCCAGATTCTGTAAGGACTTTGCACAATTTGCA
GGACCACTTCATGACAGCATCAAGGGAAAGCGTCCACGAGAGACTATTGAACTCTCGGACGATCAACTCAAGTGCTTCAAAGAGCTTAAACGCCGGTTAG
CCTCACCACCAGTTCTCGGCCTTCCTGACTTCACAAAACCTTTTGGTATTCGCATGGACGCCTCGAATTTTGCAATCGGGGGAGTCTTGTTTCAAAAGGA
GGGAGGGCTAGAGCATCCAATCGCGTATACTGGCCGGAAGATGAAGCCAGCAGAACTAAACTACCCTGTTCGAGAACAGGAGTTGCTCGCGATCATGCAT
GCTCTTCGAGTATGGCGTGTGTATCTTCTTGACCGACCGTTTACGGTCGAAACGGATCACAAAAGTATTGAGATGATTCTGACTCAGAAGACTACAAACC
GACGCGTTGCACGATGGTTCAATGAGCTTGCTGAATTCCAGCCTTTGTTCAAGTGGATTCCCGGAGAAACGAATACCGTGGCTGATGCATTGTCACGAAA
TCCAGAGTTTGAACTGAAAGCTGCTCAAGTAAGCTTACAAGAGCTACTGGAAGCAGCCAAGAATCGTGAAATTGTGGCAACGATTGTACCAAACAAGGTG
ACAGTGGCCCAAACGGCGAAGTCGATGTATTCGTGGAACAAGGATCTACAGTGGATCATCAAGAAGCTGAAGCAAGGGGATGAATTGCCTAAATACTCCT
TACAGGATGACATTCTTTTCTATCAAACTGCGGAAGACCAGACTCCACGATTGTACATCCCTGATGACGAAGATCTGAAGAATCGAGTCATTTGCGAGAA
TCACGATGCAGTAGCAGCAGGACACCCAGGGTTTTATAAGACCTATTTGGCAGTACGCGAGAAATACTACTGGCCGAAGATGATGAAGTACATCCAGCGC
TATGTCAACACATGTGAAATGTGTCAGCGCAACAAGGCGAGACAAACCAAGCCGCCGGGACTACTTCAACCACTAGACATACCTTCGGGTAGGTGGACAG
ACATCTCAATGGATTTTGTAGTGTCACTGCCTGTCAGCACCAAAGGTTGCGATGCGATTATGGTAATCGTTGACCGGCTGACAAAGCGAGCGAAGTTCGT
TGCGACGAAGACAACGGACAACACCACAGATATCGCTAACGTGTTCATGAAGAATTATGTAAAGGATCACGGTTTACCCAAAACCATTATATCCGATCGA
GACACCAAGTTTACGTCCAAACTTTGGCAGAGTATTGTGAGTGCGCTTGGTACGCAGCACAACTTGTCATCGGCTTTCCGACCCCAAACAGATGGACAAA
CGGAACGGACAAATCGATTTATCGGAGATTATCTTCGAGGTGTCGTCAACCCAGCTCAAAATGACTGGGATGAATATCTCCATTTGGCAGAAATTGCCTA
CAACCGACGTGTACACTCCACGATTCGAATGTCGCCGTTCGAAGCGGATCTAGGATATGTCCCCTACATGCCAGACGATGTGGCATCAGATCCGGAGTTT
AAGAAATTGGAGAAAACAGCGCAAGAGTTTTTACTTCAGCAAGAGACTCTACTCAAGGTCGCACAAGACCGTATGAGCGAGGCGCAGGAGCGTATGAAGT
ATTATTACGACAAGAATAGACTTGTCCAGAACTTCGAAGTCAACGACATGGTGCTTTTAGACGGAAAGAATTTGGATATCCGTCACAAGGGGTATGCCCA
GTCGAAGAAACTCGCTCCACGATACATTGGACCTTTTCCAGTGATAAAGAAGATCTCAAAAGATTCCTATGAGTTGGGATTATCGAAGGGATTAAAGTTG
CATCCTGTGTTCCACACATCATTGCTGAAACCGTATCGCAAGGACCCAAAGCGAAGGCAGCAGGTGAACAAAGTCGTGTTAGCCGATGGAACCGAAGGAC
AACTCGTTGAAGCGGTGATTGATCACCGCATGTACAAGGGAAAACCGCAGTACAAGATTTGGTGGCTAGGTGAATTCAGAGCTGATGCAACCTGGGAACC
CATTGAGAATCTAAAGCAGATTCCTGGGCTCATCGACCTCTATTGGAAATCCAAGAAGCGACCGAAGCCATTTTCAAAATAGGCGTCTTCTTGAAGGGAG
GTCATGTGACGCAGTTGCCGTCAGCGGCAGGTATTGCCGCAACTACAACCAATCTGGTTGAACAATAAATTTTCGTATGCATGTCTACCAATATCTGAAT
GGCGCAAGATATTCAAGGATAAGAACAAGAATCTGATACGTCCGATAATCATTAATTTGATTGGTCTAAATCATCAAGATTTGATAATATCCAGTATGGG
AACTGGATTTTTGATGAAACTACAACTACGTGGATATTTTAGACAAGATCATTGGTAGAACAGATAGCAGCTGAGATTAGAGAAGGATAGGCTTTAGGGT
AGGACACTAGTGGTCTCAAGGACATCCGTAAAAGCAAACAGCTCAATCTCAATCACTTCTCAATTTGCTTTCAATAGCAACAACCCCTCCACCAACCTCG
TCACCTGCCTACCCAAGGACCGCACGCCGGACACGCCAAGCAAGACCTTCCTCGGCGCAAGACTGTTACATTACGCTGTTGGCGGCGGCATGAGGTGTGG
TTGAGGTTGGTGTCAGGCCACCAAAG