Description :
From Genome Similarity Track
Location :
Scaffold_4:35273- 37924
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4-snap-gene-0.39Pseudouridylate synthase
Pytiw_DAOMBR242034maker-piw_contig_4-snap-gene-0.51Glycosyl transferase, group 1

Sequence
2651 bases(100 bases per row)
GCTGGCGCTTCAGTCTGCACATCGCGTACATTGGGACGGGCTTCGTGGGCTGGCAGCGCCAGATCGAGACGAGCGCGTGCGGCAAGAGCAGCGTGCAGGA
GCTCGTCGAGGACGTGATCACGGAGCTGCTCGCGGCGCCCAAGCGCATCAACGTCACGAGCGTCAGCCGCACGGACGCTGGCACCCACGCGTTATACGTA
TGTGCAAGAGTGCTTGGCTCATAGAGCTCTCAGTATGGACTGACATTCGAGCTGTGTGTGTATGTGTATGGACAGCAATATGGGAGCATTCGACTGGACG
CGGAGCTGCCCATGCCACTGGACAAGTTCAAGGCGCTCATCAACGTCAAGTACATAAAGCTCCGGTACTTGCTAGTATACAGTGCCTTACAGCTAACATC
ACTCTTCTGCTGCGTATTAGGTTCCCGGACAGCGTCGTGCTGCACGAGATCAAAGTGCTGGACGCGAGCGTGCGGCCGCGACGCATCAAGTCGTTGTACA
AAAAGTACATTTACTACATCCAGCAAGGCGCGCGTCCTGACCTGGAGCAGGGCAGGTTCTCCTGGTTCCTCGGCCGCAAGGTCGACCCGCAACGACTGCG
CGACGCACTTAAGCACATCGTGGGCACGCACGATTTCCGTCAATTCTCCCAGGGGCTCCAGAAGGCCGCGTTCGCAGAGCGCTCGACCGTGAGGACACTG
CTCTCCGCCACCGTGCGAGTCCGGAAAAACGTCAAGTTCGCTTTGGATCCGACGATTTGCGGCTCTGGTGAGATCGTGGACGACGAGTTCGCGTTCTTCC
AGCAGCAAGAGGATGATAAGAGATCAGCAGCAGCCTCCGCAATACCAGAGTCTCGGGAACAGAAGAAGCGCCGAGTGGACAAGCTCAGCACCCCCGTGTA
CTACATCTGCATTGAGTTGGTGGCCAACGGCTTCTTGCGCCACATGGTGCGGCGGATTCTCGGCACGCTGCGCCCCATTGGCGAGGGTACATATCCGCCA
CTCCGCATGAAGCAGGTGCTCGAGGGCGAAATCGAACCTGGTCCGTCGGCACCATCCAAGGGTCTTTGGCTGCATCGTACGTGGCTTTCACAGGAGGACT
GGGACACCGACGACAGTCGCTATGATTAGGAATAGAAGCTCCATTACAAAATTACGTACGTGTCACGATCTAAAGCTCATCATGGTCGTCCAAGTCGCCG
TTGGTGGAGCTGGTTTCTTGCTGCGCAACGTACTTCAGGATGCGCTCAATGTGGCCGAGAATGAGTTTCCCTATGACGTCGGGCGAGTACTTGGTCACCA
TGTCCACACGCGCTCGTTTCCCCTTCGCTATCGCCTCCTAATATACACGAGCAGGCATAGATCAGCTTCGGGTTTATACAGATTCATCCTAGACCTCTCA
TTAAGTGCGCATGGTGTACCTCTGGGTGGTCCTTCACGTGAACGAGCAGCTCCTTCAGGTGCGCCAGGGATGGATCCGCCCACATGTGACCTCGGAAGGC
ACCTTCCGTGATCTAAATTGCCATACAACCACAGTCAGAAGACAACCAACCACTCAAATACTACCACACCCACAGCATACCTCGATGAGCCCGTCGATCC
GCAGTGGGTACGAGTTCTCCTCGGTCATGTACTCGGTCGTGCCGCTCCAGAAGCTCGCGATTACGGGCAGCTCCATGGCCATGGCCTCCACGTGCGGCCG
TCCCCAGCCTTCCCCTCGCGACGGCAGCACAAACGCAGTCGCAGCCTTGTAGAGCGACGGCAGTTCAGTCTGCGGGATCTGCGGCGGGAGCACGTGCAGC
CGCGGGAGCTCAGTGAGTGGCTTGCCCACGGCCTCCAGCGTGAAATTCTCAATCACGTCCATGAAGTCACGCGCAGTCTCCGACTCAACGTGGTACGCGT
TCGTGAGCAGCACGAGCACCACGTCGTCGCTCTTTGCGAAGGCCTCAAAGTACGCCTTGAGCAGCACGCGCCAGGCCTTGCGCTCCTCCCACTTAAAGAT
CGAGAGGAACACGGTCGTGGCCTCGGTCACACCAGCGATCTGACTGGCGAGGTCGTACTTTGCGGTCACTTGCGCGGGGTCAAAGAACTGCACGTCAACG
GCCTCGGGGACGACTTGGACGGCCTCGGGCCGCACGCCACCATCCACAAACACCTTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAATGAGATGTACATCAGTCACTAGATAGAACAAAGCGGTATTCACAGCAA
CAGAATACGCAATGCGTACTTGGTGGGCACCCAGATCTCGTCCATGGCGTTCATGCGGTCGGGCCAGCCGCTCGGTACGCGGTCAGTCTCGAACATCGTG
CGGCCGACGGTGTACTGCGCGCCCTCGGGTGGACAGCGCGACGTTGAGTAGTGCGCCGGGTACCACGCGCCGGGCTCCGAGTGGCAGATCGCGATCGCAA
TTTTCTGGTTGCGCAGGCGCCAGTGGAAGTCGCGCGGCTCGATCCAGTGCT