Description :
From Genome Similarity Track
Location :
scaffold_253:35270- 40713
Transcript NameFunction/comments
g6357.t1 hypothetical protein PHYSODRAFT_537941
g6358.t1 conserved hypothetical protein
g6359.t1 tyrosine aminotransferase, putative

Sequence
5443 bases(100 bases per row)
CGTTCATTGGTGACGGTTGCAAAAGTTGGCGAGGCGAGTGTAAGCATCCGCCAGCACTTCGTGCGGTGCCGAGAACACGATGCGGAAATAGTTGGTCATT
CCGAAACACTACGACAAAGTACGGTTAGTCAAAAGTTAGACAACGGGTGTATGAATAAACTGGAGCTTACCTGTCCGGGCAAGACGAAGACCGACTCCTC
ATCAAGCAGCTTCTGTGTCAGATCGAAGTCGTCCTTGATCTTGGTAAGAACGTTGGTTTGGACTTTTACCTGCGAAGTATCGACGTAACAAACAATAAGT
GATGTTGTAGGAAACAGACACGACCATCGCTGCTACATACCATCACATACATCGCACCCTGCGGGACAACCACTTTCAAACCTGGAATCCTCGCCAGGGC
GTCGATAGTGAACTTTGCGTTATCCTCCAGGGCCGCGAAATACTGCTTCTTAAACTCAATCAACGACTGCTCTTCGGCACTGCCAGGAACCGGCGTCAGC
AAATCGGGGATGGCACTCTGGTGATATCAGCATCAACATGTTAGCCCAGTTGTTAATATTAACGTTGCAAGCTGACCGCATATTCCATACCTGGACTAGA
GAGTTTGCGCCAAGGATATTTTGTGACAGCTTGAAGTAGGCGGTGCGTACATCTTTCAGGATGTCATTGCGGTCGTGGACCATAACCCAGCCTACTCGCC
AGCCAGGGATGAGGAACTGTTTGGCCAAGCCACCGACCGCCACCACCGGAACTGTCTTCGTCAAGGTCGCAATGGGGAAGAACACGTTGCTCCCGAACAC
CATGTCACCATAAATTTCATCCTTGAATTCGAGTGAAACAAGTTAGAAGCTAACCTTGAAAGGCAATTATGCAAGGTTAGGAATTTACCGCAATAATTGG
GATCTTGTTTGCCTCCGCCAAAGCGAGGATGCTCTCCAAGTGAGGCTACAATAACGAAAAAGGATAAGTGAGTGTAACCTACTTGACAATGATCAATAGC
GTTGTTCCCTCACCTTTGAGTACACGCTGCCGCACGGGTTCGAGGGGTTGTTCACCAGTATAGCCTTGGTGTTATCGTCAACCAAGGACTGCATATGCTC
CAGGTCGACCTCCCAATTGCACTCCGGCTACATGAAAATGGAAGTACACAATCGGTCAATAAACGTACTCGTCGCAAAGAATTGTGAACTTGCAGGTCTC
ACCTTGAGATTGTAGAACCTGCACTCGATCTTCTGTGCCTCGCAAAGTGCTTGGTACAACGGGAATCCCGGCTTCGGGAGCAGAACGTTATCACCGGGGT
TCAACAGGCCTCGTAGAGCAATCTCAATAGCACCCGAGCACCCGCTGGCGATGATGATATCATCCATCGTCAATGGGGCTCGCATGTTACCGTAGTGCCG
TGCAATTGCTGCACGGGCTGCCTCAGAGCCAGCCGAGTGAATGTAGCCATTGTGTTGCATCGAACTATGAAGAACAAATACAGATGCAGGGAATTAGTCG
ACAATTTATTCAAAAGTGAAACAATGCTATCGTCAGCGTACCGAGTGTTGCGGACGATCGCTTGCACCAGCACGTCGGGGCAGTGCAGATTGCCAAACAC
CGTCGGATCACCTGCAAAGACCAACACGCTCAAAATTTAGATTGCAGACCTGGGAACACTAAATTGCAGCGATACCCACCTAGCGACAGCGGGATCAGCG
TCTTTGTCGACGCAGCGGGCTTCTTGATGTTGTCCACGATCTTCCGAATGGGGTTCGAGCACAACTTGGAAAACTCGGACGGTTGCACATTCCACTGCAG
TTTCTCCTGGCGCTTGGCATCAACCATGGGAACGTCGAGAGTGGGGTCGTCGAAGGCAGTGCGCTTGGTCATGTCGATTGATTGATGATGAGGTCAATTG
ACAAATGAGATCCATGTTGCAAAACGGAGAAGACGCAAAGTCCCATGCCAAGGCGTGCAATCGAGCTGTTCAGACGCTGCTAATCTTGCTGTTGAGACGC
ACTGCCCTATCTATTCCGCTGGTGACGAAGTCGACGTCGGCCAATCGCAGCGGTTTAACAAGTTGCTTTTCAGTGGTCGCGCGCATAGAGTTCAACCTAG
GGAACAGTTCCATGTTGAACCAGGTGCTTGAAGCTAGCCAAACAACGACCTATGCATATCGGCAGCACAGTCTTGGCGGAATTGCGCCTGCTTCGACACG
AGCTGCTGCTTGATCGCCTCTTCCTCGTCTCCCAATGCGCCAAACAGCACTCCAAGGAAGTCAGGCTCCAAATCGTCACCTTCCCAGCATTTGGTTAAGA
CTGCCACCAAGTCAATACTTGCATTTGTAAGAAGCTGACGCCAATCTTCAACGTGATTTGTTGCCAGAAGCCGCTGTGTCTTCACAAAGACACTGTTCTC
CAGAGACAACATCATCAGCTCACGACCGTCCTGGCCACTTGCCGCAAGAATAGCTGCAGCCGCGCTACTTTCATCTTCGAGTTTGCTGGGGACTCCAGTT
CTGGACGATGATCGCAAGGCAATTAACCGTGACTCGCATTGCTGCTTGACCAGCTCTTCCAGCATCACACGGGCGTAATACGGCACCATACGCTGGTCAG
ATACTAGTTGTTCTCGCACGCCGTCCCACCAGTAGTTAACGGCAATCGTGAACTCATCCGAGTCCACTTGATGCCACCACCCCTCGGGAATCATAAGTGC
ATCTACAGCAAGACAATCATCAGCGCATTAGTCCGACACGAACGGTTCGTTTTGAAGAGAGTACTGTACCTCCTGCCATGATTTCGAATCTCTGGGCGGA
TGCCTCGGGAAATCGCTGGTGTTTCTCGAGGTCGGGCTGCACGATGTTGACTTGGCTATGATTCACAGACTTGGTGTGCACTGGGAACGGATACATCCTC
GCCATGTCCGACGGAGGGTAGAGCGTGACCGTCTTTCGTCCGTACAAAACTACCAGAATATTTTGATACGCGTCGTAATGTAACGTCGTCCTGCCAGGCT
GCACTGTCATCCACAGATTCACTTGAGTCACAGGCTTGTCTTGAAGACACGGCGGTCTGCCACGTGCACAAATTACTCGTCAACAAACTGGCTGGCGAAA
TTCATCAAGAACTTGAGTGCCTTACAAGCAGAAGTTGTCCATAATCCTCGGCAAACTCGCCTCAATGCAGGTGGGACCAGGCTTGAGTACTTCAATGGGG
CATTGCGCCAAATAGAACTCCAAGTCATCCACCCTTTGCAACCAATGCGACTGCTTATTGAACGATGCTTGATAATAGTCCACAAAGTCGCCGAACTTGA
GCTCCACGCTCTGTCTGGCCTTCTCATTGCCGTAGTAGCAGCCACTCGATCGCTCCTTGCACGCAATTTCCACCACTACCATCCGTCACAAGTTACTCGT
CAACAAACTGGCTGGCGAAATTCATCAAGAACATAGTCGCTATCGCACTTACAAGTGTCGCGATGAGACTCGTATGATTCTAGCAGGTGAACAGACTTCG
GAGCGAACTTTGGCAGGCGCGTGGGCTCCACGCACTGGAGCGCGAAGCCCTCGAGGTAGACCGGGTCATGGTTGCCCAGCATGATCAAAAGGAGCTCGTG
GTGTGGCGCACACCGGCCAAAAATGAATGTGGCTGCAACTTGTACATGTTGCTGGCCCGGTTTGTGTATTTGTATGCTGTGTCAATTCCTCATCGCTGTT
TGCTATGATCTGTTGTTGTTGTGCAGTTATGGTGCTTGCTAAGTTGGCGCGTCATTCTAATGATGGAAGCGTAAGAGCTGAGTTCGGTGCTGCTGCAACT
TCTGCCGCAGACTTCGAGTGGCGTACGCAGTACCCATGACGTTGAGCCCACTTCTCACAGTCTTGTTCAGCACAGCGCGACCCACCGCCGTGCGAGCGGC
AGAAACCTTTGGAAATGGCGCCCTTCGTGCAGTCTGGGTGCTGGCATCGCACTCCCCCACCGTGAGTCTTGCAGCAACCACGAGACTGCACAGCACGACG
GCACCCTTCAACAGTGCAGAATTTGACACCCCCATGCGCACTGCATTTGTGGCCGAACTGCGCAACGCGCTCGCAGCCTGCCTCAACGCAGAGTCTTCGG
CCGCCATGACCCGAGCAACAGTTGTTGAAGCGCGCAAACTTCGTACAGCCTTCCACTTCGCAGCGTCGCCGGCGGTAGCGCTTCGGAGCAGGTGTCTCGC
TTGCATCTTCGACCTTTGTAGTGTCCGTAATAGGCGCGTCTGATGAAGCCTTTGCATCTACCTCTGCCGCTGGCGTTGCGCCACTTTTGCCTTCCGTCTC
CTCATTCCCTTCGCTTGCTGTTGCTTCGGCTGTAACTACTGCTTTCACCTCCAAGGATTCACTAGCAATAACCATGTCTGCAACCGTCACGGTGGGTGTT
ACACCTGCGTCGACCTCTCCCGGAACCGGTTTCTTGTGCTTGTCCTTGGCAATCACGGCTGCCTGGAGAAGTGTATCGATCCACTCGCGCACAGGGTGAC
CTTGGCTGTCTGTGGGAGGCTGTAAGACCGACGCGTCCACCTTAACAGACTGGGTATTGACCACCCTGCTCATTGCGCCACTCGTCAACAGATCAGCAAG
TGTCTGCAGATTTAGTGGTTCGCACCATGTCGCAGTTCTTGGTGTGCGCACACTAAATGGAGCCAAGTTGAACTTTGCTCAAATGCTCCACTCAGCGCTT
ACCGGTGCGTTCCGTCGTACAGGTAATCCCGACGGCAGCGAAGCCCCACGTGTATGGCAATGCTACATCTGCTCGATACAGAACGAGGTTGTAGCTGAAG
ATTCATCGCCATCGTGCAAAGCGTGCGGAAGGCCGCGTAATCCGCCATGGTTGCTTCTCGAGGACGCTGACCTGCAGGTGCGACTGCATATCCCTTTACG
ATTGACCTTCTTTGGTACTTGAATAATAAGTTACCACGCTAGATTGCACTAGGATCTCGAATGTTCCATACCAGTGTTGGTGGGTCCAAGACCGTGTCTG
TCGTCGTCACCATCAACTACGTTCAAAGAGTCGTCACACTGCTGCGAGTGAAGTCCAAGCACAATGAGCGCGGACAGGAAGACATCAGCTTCCACGAGGT
AGTGTTAACCGCCTCGCAGTTGCAACAACAACTGGAAAGTCTAGATGCTGAGCAGGAAGAGGACTGTGTAGTTGATGACTACGGCATCTGTGGCGACTGC
CGTGGTGTTTTCCGTGTTGCACAGGGGGATCCACACTCACAATATGCCAACCAAGACAAGGTCACAGAATTGGAGAAGGAGCTACAGCAGCTCAACGAGC
AGAAGCAGAGGTTTACAAGGGAGAAAGCATACGTACAAGTGCTGGAGTGGACGAAGAAGATTGAGCTTAAGGCAAAGGAGCTTCAAGTCGCGAAACGCGA
ACTCGAATTCCTTCGTCCTGTATTCTGCCCGTTCTGTGGGTGG