Description :
From Genome Similarity Track
Location :
Scaffold_18:35268- 37083
Transcript NameFunction/comments
Phyra_76382glycoside hydrolase, putative

Sequence
1815 bases(100 bases per row)
AAGGTTGTAGAAGTTTGGCATGGGGTTGTACGAGCACATGGTGTCGATCCAGTCGCAGTCCTCAGGCGAGTAGTATCCTAGGCCGTAATTCTGCGCGCCG
TACGACGTGAACGGGTACGCCGAAGCGGACGAGCCCGAGCCGTCCGAGTTGGCCAGCTCCGTAGCGTACTCGAAGACGAAGCCGCCCGAAAACACCTCAC
GGAACGAGTCGCCCAGCAGCCAGCCAGCCTGACGCCACGTGCGCTGCGCCTCGTATTCGCCCACCGTCGGGAAGCTTGGGTTCACGCAGCCGTACTCCGT
GAGCATAACTGGGATGGACATGCTGTAGTTGGTGAAGTCCGTCAGCAGCTCCGAGAAGCCATCGGCGTCGGCGAGCTTCGTCACGTCGCCGTCGCAGTAC
TGGTACGTGTTGAGACCGTACCACTCGGCGTTTTCGTACTTGTCGCTCGAGTCCGTGCGGCAGTTGTAGTACTGGGCGTTGAGCTCACGGTTGTTGGTGG
TGGTGTCCGGGTCGGCCATCACAACGCCAACCGGGACGCTACGCATCGTGGACGAGCAGCCGCCGATGAAGGCGCGCATGTCACGGATGAACTTCTTCTG
GCACGGGGCATTGGTGGCGGCATCATCCACCAAGTTGTTGATCTCGTTACCGGCGCTGAAGCCCAATGTGTTGTCGTACTGTGCGAACTCGGTGATGATC
TGCTGGCCGCGGGTCTTGAGCGCGCCCGGGTAGCAGGCCGGGTACTCGTCCACCGTGATGGAGCAGTTCTCGCAACTGGCGCCCAGGTCTACGAGCGCGT
ACATGTTGTACTTGCGCAACTCGCACATGAAGTCGTCGTGCGACTTGGACGGATCCACGGCGTACAGCCGCACGGCGTTGGCGCCCGCCTCAGAGAGATA
CGCGATGTCGTCCTTCCAGATGGAGCTGTTGTCGTCCGTGAAGAAGTCGTAGTTGTTGATGTCGAGCTCGCCCGCGTTGGGGCGCGGGTAGTAGTCGACG
CCCTTCACGGCGAAGTAGTCGCCCGTGTTCGAGTCGAACATCTTGTAGTTCTTGATCACGATGGGGTTCGTGTAGCCGCTGACGAACAGGCAGGCGGACG
ACGCCAGCACCACCACGGTCGCGACCACCTTGGAGAACTGCATGCTGCGAGTCAACCTCTACGTCTACTGAAGACAATACGTCTAGAGAGCTGGGGGAAT
CTGCCGTTGTGGGGCAAATTGGGGAATGACCGTGTACTGAGCCGTGCACCAAGTGTCCTCGACCGCCTGTTGGTGGTCAAAGCGATCGCCGATCGCGCGT
TGGACTGCGGCCGCTTTTCTGCATGGCGCGTTCCGTGTGATCCTTGCGCCAGCTGTGCATTACAGGCAAATCGCCCAGTAGCGAGGCGTGCCGGCGCGAT
CGATCTCAGGACGCTTGCTGTCCATTTGCGTCTGATGGATTTTCCTGTCGCCGCTGCTGAAATAAGACGCCGCTCCGCCTACTTGAGATCATGCATCGAG
TCTCCACTTAACGCCAAAGACAGATGACAATGCAGTGCCCGTCCGAAGCCATTTCTTCAGCCGTCGACCTGCAGGATAATGACTGGCTTTGCACATGCCG
CTCGTCAGGATCTGGCAGGCCGACACCAATAGCAAAGTTGGGATCGCCGTCCGCGGGCAGGTGTGCGTGCGATAGCTAGCATGTAAAAGGATCTCTTGCT
CGCTGAGTGCACTTGCATCCGCGGTCTACACCTCCTCTTCGTGACGAAGGCCGCGGTCGCGAACCCGTTCGCCACGCGACGACATGGCCGCCACCCTGTC
GATCCGCAGTGGATT