Description :
From Genome Similarity Track
Location :
Scaffold_24:352663- 353676
Transcript NameFunction/comments
g4833.t1hypothetical protein

Sequence
1013 bases(100 bases per row)
CTTACTCCTCAATTTCCGGTTTTCAGCGGAGCTCGCTCCCCCCTCATCGAACATGCCAAGGAGTCCACACTCTGCTGTCTCCCGCGGTCGTGTTCCCGAG
GCTCATCGTGCTGGTGAGGATTGGATGTTTGTTGCCAAGCACAACGGCATTTCTCCAACGACGGCCCGTCGGATCGTTGCCAGTGACCGTGAAGAGCCAT
CGCGTCGTGGAGGCGCACGCAGCGCTTGCATCAAGTGCACCCCGGAGATAGTGGCAGCTCTCGAAGGGTACCTTAACGACGATTGCACGTACACATGAAG
GACATGATTCTGTTCGACTTCGGTGTGAACATCAGCACATCGACCATATCGGATAGACTCCTGGGGATGCTGTACACGCTGAAGCAGGTAAGATGCTGTA
AGTCGCCATGCACTCCAGTTAACACCTCATGTTCTAATGGCTTATATTATTTGCGATCTAGGTCCGTGTGGAGCCTCAGACGTGTCAACAAGACCAAGCG
CAAGCAGTTTGCTGTGGACCTTTGCAAGCATATGGATGCTGGCGATTTCGTTGTTTACTACGATGAGACGAATTTTAACGTCTATTGCAAGCGCAGCCAA
GGCCGCGCGCGAAAGGGCGAACGAGCGACGGTTGTGCTACCTCCTTCCAAGGGCGCCAATCTCCAGATTCAGTGCGCCGTCTCGACGGAGGTTGGGTTGG
TTCACCACCGCCTAGAACGTGGCAGCATCCGCATGGATGTCAACGCCTCATTCGTTGACGAGATTTACGAAAACGTCAAGGCCTCGCCAACGTTTCAGGA
GCATTTCGAGGGCAAGAAGATCGTGGTTGTGCTGGATAACGCGCCGGCACACAGCCAAACGGAAGAACGGGTCGTCGAGCACGATGACCTCGTTCTTCTC
CGCTTAGCGCCATACTCCCCGACGTGCAACCCGATTGAGGGTTGCTTCAGCGTCCTGAAGGCTCGAATCAAGGCGAACCCGGCGTTGCCGCGAGAGGAAC
TGGTGGCAAGTCG