Description :
From Genome Similarity Track
Location :
scaffold_83:35264- 36290
Transcript NameFunction/comments
g940.t1 integrase putative

Sequence
1026 bases(100 bases per row)
CACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATG
GAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATG
CAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCT
TCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCG
TGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTT
GCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGC
TTCTGGACCATTTTGCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGATCATCT
TGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCA
GTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGCGCCGTCGAACACGACTTGGAACAGACCA
CTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAA
CCACTCGTTCCACGATGGTCCCCACA