Description :
From Genome Similarity Track
Location :
Scaffold_57:352627- 353794
Sequence
1167 bases(100 bases per row)
TGGGTCTTGGACATCGTAACATGTTTAAAAGGAAAAGATGAGATTATGGGAGTCTTGGCAGCGAGCATCACGCCCAGATTCGAGATGGATGAAGCCCTGA
TTAAAATCGCTCCTAAGAAAGAGCCTTAACACCAGACTCAGATTCCGATCCCGACAGTGCGGGTGGAAGAAGATCTATACGCTCTGAGTTTCGATGGATC
CGCCCGTGTTCGACGTGGTGGAGGTGCTTACAGTGCGATTCTATGGGGGCTGCCCGAATGATAAGTGGTAAGAGCCAGACCCACTTACGCGGAAGGTCTC
ACAGTTAATGAGGCGGAGTATAACGAACTCTTGTTCGGGTTGGATTCGCTAAAGGATGAGGATCCCAAAAGGACTGGTGGTGTGTGGAGACTCAAATTTG
GAAATCCGACAGGTGCGAGGTGAAATCGACTATAAAGTCCCTGCATTAACGTTGCAACGACAAAAGGTGACGAATCATCTACGTGGATGAATGAATCACG
AGATGCTGCATGTCAAGCGGGATTGGAATGTAAGTGCGGACAGCTTGGCAAGTACCGCTCTATGGAATCAATGTGGGGTCGAAGCGGAGAGAGAGGTCGA
GCGCCAGGATCTCGTCACACTAAACCGACTAGATGAATTGATCGTAGTTGGGCCCACGGAGCGAACAGCCCGGGTTACAGCTGTCACTAGATCCAGAGGA
AGGGCTAGATCCAGCTCCCGGAACCTCGATGAGACGTACGTAAGGGGGGGGGGTCCGAATTGAGCGGATCCTCGAAGCACAAAACGAGGAGACGTGGATC
GCGGGACTTAAGAGGTATCTGACGGGGGATGTACGAGATCTGAGTCGGGAAGACGCCAAAGCCTACGATATTAGATCTATGGATTATGAAGTGGATCTGA
GCGACTTACACTTCTACTGTCCTCCTACGAAACGGAGCAGTGAAGATCGATATGAATTGATGAAATTGATGATGACATATACCTTACATCGGTACGTCTT
CCATCTTTATCAGGCTAGCTTGGAAGGGAAACATCAAGGAATCGGTCGAACCTACCAGCGGATCCGAGAATGGTTTCATTGGAGTAGTCTGTTCAAGAGT
ATGCAACAATACATCGGCGAGTGCGTGGATTGTGAAACAGGCAAAGGCAGCCCTACTATCGATGGAA