Description :
From Genome Similarity Track
Location :
Scaffold_323:35261- 36309
Transcript NameFunction/comments
Phymu_g8603hypothetical protein PHYSODRAFT_323421

Sequence
1048 bases(100 bases per row)
GAGTTGGGGTCCAAAATCCACTCGACAGCACTCGGAAAACCCTCAGCAACGTAGGAGGGAGGAGGATCTAAACAGCTTCGACTGAGTTGCCACACTAAAG
ATAGCCCAACGGAAGCCAAAACGTACCAATTTTCGCTTCATCGCCACTTCTGTATTTACCGGTCTGGACGAGCACGCCACGCATTCCCAACACCATGGCA
CCGTGTACGTCTTGGCGAACGTCATCCCCAACCATCACCACCTCTGCCGGGTCAACGTTCCTAGAGAACAACAGCATTTACACGCCTTGTATCAGCACCG
CAATAACGGGTGCAACAGACAGTTGCGTGCTCACATGTCCGTTAGCGCTTGCCCGTAAAATGTTGGTGTGGGTTTTCTGCACAGAAGCAATAAGTTGTAC
AATACGGATCGTCATGTGAGTGTCCAGGTCACCTGCACCTGGACGAGGTGAAAGAAAATGCGATAAGATGAAGATGCAAACTTATCGACAATACCCAATG
ACAGTCGCTTGAACGCCTGCTGAAAACTCCAGCGCTTTCACAAATGCTCCGGGGCCAATATTAAGTCCGTCTTTCCCAGCAAAAAACCGCGCTTCGTGCA
GTGCTATCAAAGATCCTCCATTTAGCAGCACGCGGAACGCTTCATTAAGCTGTTCAAAAGCAAGTAGTTAGCATTTACCTCCTACGCACACGTGGGAACT
TTTGTTGCATATACCTTATCGTAGTGGAAGTGCTCAGGAGCCAAACCCACGACGACAGCGTTCGGGTTGGTGCGGTCAAGTCCGTCGAATTCTTCCTCGA
GCGAAGgatccaccagcagcaacggacgAAGGTTATGTTGCTCTAGCACGCTACGAGCGATGCCTCCCGATGTCAGTACGTGCTCTGCTTTAATGTTCTT
GAGTCCAATATCGTGCAGATGTTGGATCTAGGGTACACTCGTCCATTAGCCTTGCAAGATTTTTAGAAAGTCTGTACGTACGAGACGCACCAATTTGCGT
CGAGACTTGGTTGTCGTGTTGGTCACTACCGCGGAAGCAATGCACGTA