Description :
From Genome Similarity Track
Location :
Scaffold_728:3525- 8832
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_728-fgenesh-gene-0.1Lectin
Pytir_DAOMBR486maker-pir_contig_728-snap-gene-0.9G2/mitotic-specific cyclin
Pytir_DAOMBR486maker-pir_contig_728-fgenesh-gene-0.2CG15877 CG15877-PA

Sequence
5307 bases(100 bases per row)
CAAACTGACTGACTGCGATCGCACGGTGCTTGGTGGCAGACCTGTAAGGGTCAGTGCGTCTCTGCTGGGTGAGCAATAATAGCACGCACGCACACTCAGG
AGCATGCGCTTTGTTTGGCGGCGATGCCTCTGGAAAAAAGAGCGGCGGCGCATTCATGCGATTGTGTACCCCAGTATCTAATTTGAGTATTGAAGGAAGC
CATTTTCATGAAAAAGCGGCATCGCAGCTCGTTATCAGACTCAGCCGAGACGAGTTGATCTGATAACAAATCGAAAAAGAGTTCAGAACCATTGTACCGA
TTAAAACCGATATCGTACTTCATCAGTGATTTCATGTGACTGAGAGGAGTGAACTATTGGCTGCGTCCTATTAGATTCGACTTTGCGATTGAAATCGTAC
TTTAAGCATCACTATCGGTATCCCTTTTGATGGGACCAGAGATTGCTCCACGTCATGAGCATTTCCAGTTCGGCGACGACGCGAATCGAGCGCACAAGGC
GAGCAGCTCCAGTCCTCTGTCGCCACTCTCTCTCCCTCCCTCTACTACATATCACTATCAGCGATGCAGATCCTCAAGACGCTCGGCCTTGTGGCTGGCG
CGCTGCTCGCGACGCTCGGCAGCAGCAGCACCAGAAGCGGTGTGCGCGCCGAGCCGCTGGGCGAAGTGTCGTTCGAAAAGCCCTTCGAGATGATCAACGC
CGACGGTATGCGCATCCCCGGCTGGAACTGGGACATAGGCGGCGCCACGACCGTGAACCGCCACTTCATTCGCCTGACGCCCGACCGCCAGAGCAAGCGC
GGCTTCATCTGGAGCAAGAAGAAGATCGAGAGCCGCGAGTTCTCGATCGTGCTCACGTTCCGCATCAGCGGCCAGGCGCAGTCCTGGTTCGGCGACGGAC
TTGCGCTCTGGGTCACCGACTCGCAGAAGCACATTGACGGCGAGAACCACGGCTTCACGGGCAACTTCAACGGTATCTACTTCGTCGTTTGCTGTTTGAT
GATGGTGTGAAGGCTTGTGACTCACTGACGCGATTGTGTATTGTGGTTTCGCTTGATCTCGTGCAGGTTTTGGTGTCCTTTTCGACACGTTCGTGAACTC
GGAGCACACAGGCGGCCACCAGGATGTGACGCTGTTTGTGAACGACGGCTCGAAGACGCTCGACCAGCTGAACGACGAAACCAAGGTTGGGTGTATGGCG
CCAGGCATCCGCTACCACGAGCGCAACGCGGCGTTCAGCCCGTCACTCAACATGTCGCGCGCCAAGATCCAATTCAAGGACAACTACGTCGCGATCCTGA
TCGACGCGAAGAACACGGGCGACTGGGTGCACTGCCACAGCGGCTACGTGCGCTTGCCGCAGAACTGGGCCGATGACGCGACGATCGGTATCACGGCGTC
GACCGGCGGGCTCGCGGACAACCACGACATCATCGCGCTCAAGGTCTACAAGTAAGTGCCGCGTATTGTGTGTGCATATGTCTAGTGCACCTCGCTTCAA
GAGACTGTTTGATTGACTGACTGCATGTTACCAATGTTGTATGAACAATTCAGCGACGTTGGCGACATGGCGCACGAAGAGAGCGACCAGAAGGTCAAGA
ACGCGACGGTGCACGACCTGGATGAGCGACTGAGCGAGGGTGACAACGAGGAGAAGCTGCGTCTGCTCAAGCGCAAGTACGAGCAGCTCATCGAGGACTT
TGAGCACCAATTCACGGCGCTGAAGGAATCGACGGAGAACACGATCAGGAAGCTGCGCGAGCAGGAGGCCGAGGACACGCGTCGCATCGCGGAGCTCGAG
GCGTGGGTGAGCGGCAAGGTCACGGAGCGCGTGGCGTCGACCGCGAACGCGATCCGCGACCAGGTCGACGAGCGTCTGCAGAAGACTGTGGAAGAGACGG
CGGTCAAGTCGACGGGCTGGAAGACGCCGTTCTTCGTACTCGTGCTCGTGCTCGGCGGTGTCGTCGCCGCGGGCTACAAGAAGTACCAGGACTTGCGTAA
GTCCCACTTGCTGTAAGGATGAAGCCTGAGTAGGTGAGTGGACAAGAAGAAAGGAAGGGCTGTTTGGTGCTTGCTTGCCATGAAGAGTGTGAACCACGTT
TGTTTGTAGGAAATGGAATACATGCACGTCGTTAAAAAGCACGATTGCGCTGTTTGCTTTGTTTTACACATTGTGCGTGCTTCCTGCATACATCTATATA
TCCATCTATACGTGCATCACCACCCATCCATTCTCTACTCTGGTTATTATACTGGATGGTGGGTGCGTTGTTCTATATATTTCTCTATTGTATGGGATTT
CTCTATGTATCATACTAAGTTGAGGCTGCGTTTTGCCGACAGCAACAGTGGCGCCGCTGCGCTCTCCATGAGCTCCTCGAGCTCGTCCTGCGCGTCCTGC
ACGTTCTCGCAGACACGGCAGATGCAGTACGGGTCGTAGGGCACGCGCCACGGCGCCGGCAGGAACGCGCCGTACTGACAGCGCAGCGCGAACCACGCCT
TGAACACGTGATGCTTGGGGTTGATGTTGTCGCGGTGCGCGAGGAAGAGGAGCACGACCGGCGCCAGCAGCGGTGGCTGCACGTCCGTGATCTGGTGCTC
CGAGATGACGTACCAGATGGCCTCCACGAGCAGCTCCTTGACGAACTCCCGGGACCGGTCTTTGAGCAGGAAGAGGTCGGCAAAGTAGTACGCCAGTTGC
ATCTGTAGGTTGAGAGAAAGCACAGCAAGGTAGGCGAATGAATATCTTGTGCTGCTTGATCGGATAGTCTGGGGGGGAGGGAGCTCTGTATCGTACCTTT
TCATGGGCGAGAGGCTCGTCCAGTCCGAAGATCTTCTTTTGCAGCAGCCCGAGCGTCGTAGGTGCCATGATGCGGAAGTTGAGCTCCTTGAGGATCTCGG
TCTCGACTTCGATGATCTGTTGCCATGTCCACTGTGAGGAGAAGGAATGAGCAACAGCATCTTTTTAGACTCGTGAGGTTTGTACAACGTGTCGAGATTA
GAAACGGCAGACTTACGTTGCCCGAGTGTCGTCGCTGCTGCAAGATTTTCTTGATCGACTTGTCGATGATCGTTGTCGGGGTTTCCATGAACTTGACTGC
AATCCACAGGCAGCTGTTGTACATGAACAAACACAAACAAAACAGCAAAGATAAAAAGATGAGCTCTTTGCTGGTATCAACGCACCAATAACCCAACAGT
GGTATGCACGTACGCAATGCTCAGTGTCTCCAGTCGAGATGCCTCGACTTCGCGTTTGGCCATGAAGCGGTCCAACACGTCCACACAGAGGTGCAGTGTC
TCTCGCGCGAGTCCGAGCGCCGATGCGATCGTCAGGATCGCCGCCACAATCTCGTCGCGGTGCACAGACGTCGCAAATTCCTTTTCTTCTATCTGGTTGT
CGCAATCGTGCGCTTCTGCTTTTGCGTCCTCCTTCTCTTGTTCCTCCTCTTCATCGATCTCCTCCTCGTACTCGTCTTCATTGTCCTCTTGTGGCTCACA
ACAGACTGGCGACATCTTGCACCGGGACTCGAGCAGTTGCTGCTTCACGCTGGCATTCGCTGCTGCTTGAGGCGGCGACGAGTAGTCTGCTACACCTGCA
AGCGATGACGCCGCAGTAGTGGTCGGCGCACTCACCTTGTGCAGCTTGGCGCCATTGCGGAGCGATGCACCTGCTTCTGGAGATGAGCTCCTCGGTCGCT
TGCGGTGTACAAGCTGACACATGATGCTCGAGCGAGTTGCAAACGGCGGCAATCAAGCACAGGTCGGCCGGCCGGTTGGTAGTACAACAACTGAGCGAGC
GCAGTGGGAATTGACTGATCGCCCTCTGCTCAACCAGCGCGCAAGAGGAGGAGTGATGATGGCATTCGTCAATCGCTCTCCTCCTCCGTTTTTTTGGCGC
GCGATTGATTGATTGACACATGGATAACCGCATCAAAAAGCTTTGCCGCGCTAAAATTGAAATCGAACAGTAGGGGCCACTATTGAGGTGTGGGGAGCCG
TTACAAAATCATTCCACCAATCAGGGAGCGTGGTTGCTTGATTCCACCAATCAACGCGCTACGATCGTTTCAGAGGGATAGGGCTTTTGATTGAGTTTTT
TGGCGGGTTTGACTGTGAGGCAGGCAAATTGAGGCAACGAATGTCAAAAGCACCAGTACGAGACCAACCAAAGCGTGCAACAAACAGGACGTGGTAGCAC
ATTGGAGGCGCCCACTGGATGTACCTTTGCGTTTGCAGTGTAGTGGGCGAAGTAGTTGCATGATCACACGAACAATGTTGTAGGGATCGCAGCATTAGAG
CCTCCATGTATTTAGTTGCGTGTCTTCAACTTCTGACAAACGTATCTTGGATGTGTTTTCGTGTGATCCACATAAACCCTTTCAAGTATACTAACAGGTT
TATATGCTTGATATAAGAGGCAAATAGATAACAACCTCGTCAATTGAGTAGTCAGCACTCTTTTTGTCTTTTGGCCGTTCGGTGGACCAAACGGCTTGCC
ATCCAATCTGATAGGCAAGCAGCAAGCGGCGCGTGCATTGACGACTCGACTGCGTGCGCACGGATCCATCTCAGCGCTCCTCTGCAGCGACTAGAAGGGC
TCACACTTACAAGCACCTACACAGACACTTACTCAGACAGCAGCAATGGGCGCGGCAAAACCATCGAAGAAACAGCGCGGCAAGAAGAACGCGGCGTTGA
AGGCGAAGAAGGCGAGTGCTGGCGCAAGCGCGACGGGTGCATCAGGCGCCACTAGCATTGCTGTCGCTCCCAAGAAGAAGAACCACGTCAAGTTCGACGA
CGACGGTGAGAAGGTGACCAAGGGCACGGCGTTCCTGAAGAAACGCGCGCGCACCGCTGCGGCTGCCGACGAGAAAAAAGAGGGCGGCGGCAAGTCCGAC
CGGTCGCCCGAGATGATCCAGCAGGCCAAGTACTACCTGGAGCAGTGGAAGAACAGGAACGAGCCGGCACCAGAGGGTGAACTACCATGGAAGTTCAAGG
TAAGAAGGATACGCTGCTGCCATACTGCCTGTAGTATGTGACGACGGAGGCTTGAACTAATGGCGCGTGCGCTTGTGCTGCTGTAGAAAATGAAACAAAT
GTGGATCCTCCGATGGATGTACGAGGCCGATGTGATGCCCAAGTCCATGTTCACGGTCGTGCTCGACTACCTGAACGGCATCGAGGGCCAGGCGCGACAG
CGCGTGCTGGACGGCGCGCACGAGATCATCGACGCTGGCGTGCCCGGAAAGACGACCGGCGGCGGCATGGCCGAGGAAGAAGCCGAAGAAGACCTGCCCA
CGAAACT