Description :
From Genome Similarity Track
Location :
scaffold_169:35249- 36394
Transcript NameFunction/comments
Pl_108374hypothetical protein PHYSODRAFT_320441
Pl_108375Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1145 bases(100 bases per row)
TACACCTACTACTTTTTCCCGCGATCGAAGAGCAAGTGATCCGAATGTACTTGTCTCTCCTCAAAGTGGACCCAGCATTTACGCCGTTGGAACCTCTGAT
TCCTTCGCTCAGCCAACGCTAGCTGGATCAAGTAGCACTGCTCATCTAATAATGCCGGATAACGAACTTCTGCTTCGGCTGCTCGATATGCAGGAAAGTT
TTCAGGAACGACTCATGGAAACTGAACAACGGCTCGAGGCTAAGCTGAACAACCTCACCAAAATTCTTATGCGGCTCGAAGGCATGATGGAGCTTGACGA
CTAGAGAAGAAACACAAAAGTAACTATTTATTCGCTACTAACAAAACTTTTGAAGTGCTTTGAAACATCGCAAGTTTCAGTTCTAGTAGATCGATTTCTC
CGTAGTACTCATACTACCCTTCGGGACTAACATCTCCATGAAGAGTGCAAACGTTTCGACCCACACGTCCATAATTTCCTGGGACGCTCCACGTAATGCA
CTCCTCAGCTGCTGACTCGCGCGTCTTAGCTTTACATCGTTTCCAGTATCTTCATTTTTATCACTGCCATCATCCTCTTCGTCGCCATCACTGTCATCAG
AATCACTAACGTCGCTGTCGTTGTCGATGTCTTCGTCGTTTCTGTCACTCACAAACCAATCGGCCACAAATTCTGAGGTGGTTTTCTTTTCACGTACAGC
AAGGTGCGCAGCAGCAAGTACGAGGCTAAAATATGGATGTGACTGCACTGCTTGAAGTAGTTGGTCCGAGTTCAATACGAATAGGTCACAGGCGCGGATG
CTTGTCACAGTCATCAGGCTGACAGAATGGCCCAGCAGACCAATTTCGCCAAAGTAATCACCACCTCGATAGCGACTGGCCGGGTACATCTCCTTATTGG
AAATGCTTTTTGACAATAAGTAACCACGCACTACGAAATACATTGCCTTGCACACGCTCCCTTCCACGATAACATTTTCACCTCGTGGATATCCCTCAAA
GCGCAGACATTTGGCAATGGAATAGGTGAGGCTAGCCAGTTGGAATCTAGCGCCGTAGTCGGGCTTTTCGATTTTTTCACGTTCTTGCAATCCAACCTCC
CTGTTTTCAACATCGACAACATTCTCAACGGAGGTTTGAAGTCCT