Description :
From Genome Similarity Track
Location :
Scaffold_254:35243- 40802
Transcript NameFunction/comments
Phypl_g6025serine hydrolase (FSH1)-like protein, putative
Phypl_g6026elicitin-like protein RAL7B
Phypl_g6027hypothetical protein
Phypl_g6028sodium/glucose cotransporter, putative

Sequence
5559 bases(100 bases per row)
TCCAAGAAGATCCGCGTGCTATGCTTGCACGGGTTTCGCACCAACAAGCAGGTGATGATGGATCAGACTCGTGGCCTTCGAGCGGCTCTAGGGGATTCCG
CGGACTTCGTGATGCTGAACGGCACGTACGAAGCCCGCGGGACGAGTGACCCGATGATCGAGAGTGCGTACAAGTCCAGCGCCCCATTCTACGAGTGGTT
CGAGAACCAACTGACCGACGGGTCTTCACTGCTGTACAACGACGCTGAGTCGTCCGCCAAGGCGCGGCTTCAAAGCGGCGCGGACCAAGGAGAAGACCAC
GCGTGGAGTCTATCCTACAAGGGCGTCGAGCAGTCCATGGCGAGGATCGACGAGGAACTCCGTCGCCACGGCCCGTTCGACGTCGCCATTGGGTTCTCCC
AGGGggcagcgctgctcacggTTCTGACGATGTGGTACCTTGGCCACGGCAACGTGCGGTGGTGGAAGCTGGTCATCTGCGTTGGGGGCGTGGACGTGAG
TGCTGTCAATGTCAAGTCGCTGTTCCTGGACAAGTCGGGCAACCGCGTTCTCGTGCCGCTGCCTTCGATCCACCTCATAGGCAAGACGGACCCGCTCTAC
CACGAGTCCCATCGATTGGCTTTGTCGTGGGCGGACAGAGCGGAGCCGAACGCTTTCAAGAAGCGAATCTACGTGCACGATGGCGGACACAAATTCCCAT
CCGCGTCGAGAAACCGCGCGCTCTACGCAGAGTTGGGCCGTGTCATCAAGCTGCACTGCAACAAGGGAACGGAGGCGTGTACGGCCAGGATGTAAACACC
TACCGATAGCAGCattcatttttttttttcagaAGTCTCGTGAGCAGATGACTCAAACATGTCAAGTTAACATGTAAAACGGAACTTTCATTTCATGAGG
TCAATTACGACGAGCGAGCTGTCTGTCCGTGTCACTGTCGTTCTGCCGTAGTCGTTGCGTAGCGAGCTTGCTCGCTTAAGCCGAGAGGCCGAGAGCCGTG
CAGTTGGGCAGGAAGctctccgccagctccagcacgttAATGGACACGGTGCCGAAGTCGATCACGCAGTCCGCCGGCTCGAGGGCCAGGAGGTCAGCGA
TGAGCGAATAGCAGTCCGACGTCAGGCACATGAGCAGCACCTGGGCCTCGGACGGGTAGGTCGTGGGCGGGACGAACGAGAAACCCGAGGCAGTCTCGCA
CGCATCAAGGTACGGGTCCGAGatgagcttcagcagcttggtggTAGGGGCACGCGGTGGTCTCGTCGTAGGCGGCAGACTGCGTGGCGAGgcaggcgac
ggcggcggcagcgccgtaGGGGAAGGTCTTCATGGTGTTGGAGGGAGGAGATGGGGAAGCTGGTGTTGCGAGCTTGGGGGAAGATTGGATAATGAGGTCC
TGGTCGTCGTTGACACGGAGGCCGGTGAAGCCAAGGACGACCAAGGTGGCGAAGAACTCTCGTCAAACACCACACGTCTCCGACGTTGTTGTGAccgtca
gctgcagcgtgaccCGACCAGAGTAACAAGGCCGTCTAATCTGTGGCACTTTTGCTTGCGCTCACTGCAACAAGGATGGTGTTCATGCGAGAGTTTGCAT
TTCCGGTCCGCCCACTGCGATCCTCTCGTGACTACCGTGGCTCGACGTAAAGCTCTGGACGAGGTCACTGACACCTTCAACGAGTTAAACTGCTGCCATC
TGATCCCGAGCGGGGACCACGTAGATAGTATCGTACAAACGGGACTTTCGCTTCCGCCGTTGGGGTCTCCAACACGGAGCGATCGGCTCGCAACAGCGTT
GAGGCTTCGCCGTCTCTAATGAAGGCTCATGAAAGCCACGAAGAAGTCATTGGGTAGTCTGGCTGTTGGCTCTGCTTCGTACTCATACTCAACACATAAC
TCGAAAGCGATCGATCCTCGTGGTCTTTCGCCTTTTCCGGCGCTATCTCTGAGTCAGCGAAGGCCTCCAGACTGGTCTTCCCGTCGTAATTCCACGGTCG
GTCTCTGTGCCTCAAGTTGGCTGGATTGTGTATCACTTGTGTATATTCACATACCACCCTATTTCCGCCTAGTACCGTCTCATTGCGATCTTCCTGCAGT
AATCATGCCCTTCATCGTCCACCTCGAGctgatcgcgctgctggcgctggtccTGCCACGCTCGACTTCGCCACATGTCGTCGAAGTGCACCAAGTTCAA
CGACCACCACAGCCGCAACAACCGTTGCCTCGGTCTGCTGCATCGTCTCAATGCGACTTCACCCAGCTGCACCCTCGACGATACGCCGCCTACCACCTCC
CAGCGCCTGCCGATCAGCTCTCGCCAAGCATCTCCATCGACGGAGTTCTGGACGAGAAAGCGTGGGCCCAAGTGCCTTGGAGCGAGCCGTTCCAAGACAT
TCGCGGCCCAACGTTTTGGTCACAGCCGTGGTTCGCCTCCAAGTTCAAGCTGCGGTACGACCACGAGTTCCTATACATCGGCGCGTATGTAGAGGAGACC
GACGTGTGGGCCAATGTGTCGCGCCGCAACGAGGTCATCTTCCATGACAACGACTTCGAGGTGTTCGTGGATGCCGACGGGAGCACGCACAACTacaagg
agttcgagctgAACGCACCAAACGCCACTTGGAACCTGTGGCTCAATCGTCCGTACAGGGACGGCGGCCATGAGAACAGCACGCGAGTGGACCCGCAACA
CGGTTTCGACATGTTGCACGGCGGCATGCGGTCTGCAGTGTTCGTCCAAGGACATATCAATGATCCATGTACGTGCAGGTTTGAAACGTTTCGTGGTGGC
ATGGAATCTGATCGTACAGTTTTTTTGTGCCGCTTTGTAGCCGAGCGTCTGCGCTACTGGACGACAGAGATTGCGCTTCCGTTGTCGGAACTGGCATCGC
ATTCGTCTGCGCGAGTTCCTCCAGCGTCCAATTCGTTTTGGCGGATCAACTTCTCGCGCGTCGAGTGGCCGGTTCGCGTCGTCACCGATGGCGGCACCGG
CAAGCAGCACTACGAAAAAAAAGCTGGTCTGAGCGAGGAAAATTGGGTCTGGAGCTCACAATACGCTGTGGACATGCATCGGCCCGAGTGGTGGGGATAC
CTTCAGTTTCGTCCGCGAGGCGAGAGCCCACCCGAAGCGGTAGACGGTGAAGAAATCGTACCGCTTGATCCTGAATGGGGAGTCCGCTACGTAAGTTTTC
AGTTCTACTACGCGCAGCATGCCTTCCACAAGGTAATGGGGGCGTACACTTCGAGTTTGGAGCAACTTCTGCCGTATTTCAGTTCCCGCGAAGCCATCCA
GTGCATCAAGCTACTTGACGTGAGCGCCACAGACAAGTCTTTCAATGCTCAAATCGGGTTGAGAGAGAGTGCAAACCTCCTGGGCGATGCATTCGTGGCG
AGTATTGAAGACGACGGGTACATtgtcgtggagaaggtgacCCGGGAGATCGCTGCGATCGAATGAGAGCCTAACCACCTTGAGTTGGCATGACAAAAGG
ACTTTGTATTTCAGATTTACAATGGTGCTTCACGGAAGCAACCGCACAATATGTACGTACAACTTGCTTCTCCCGTCTTCGACCCTTACGCGAAGTAGAT
CCACATGCTGAACGTGACGGCAAGAGCGGCAATACCACTGCCAGCGACGAGAGTGTTGACCCACATGGGCTTGGCGAGCTCCGTGGCGTCGAGCTTGAGG
ACCTTGTCCCAGTGGATCATGTACTTGCGCACGTCCTCCGAAGGGCGGCTCTTGTGCTGAGTAAGCAGACTCACCACGACGCATACGACCAGAGCGGTGA
GCCACAAGAGCAGCGCAAAGTGCTGGAAGTTCATGTAGAAGAAGGTGTTGACGACGCCCGGGAGGTCTCCGTCCATGCTGTCGTCCTTGATCGTCACGAA
GATAAGGCGTGTGAAGCCCAGCAGACCGCCCACAATCATCGCCGAGAACGCACCGTACACATTCGCCGGCTTCCAGGCGACACCGAGCACGAGTACGATA
CCGATGGGAGGGGTGAGGTAGCTCTGGATctccacgatctgctcgtaGAGACCCGTTCCGTTGCGCATAATGGGgatccagcagaagctcagcacGGCAA
AGCAAAGAATGCTCATGCGGCCAACccacacgagctgcttgtgcgAAGCGTCCGGCCGGAACTTGAGATAGATATCGTTGGTGACAACCGACGAACCAGC
AGCGAAGACAGACGCCAGACTCGACATCATCGCCGTAATGATACTGGAAATCATGAGACCAATGATGCCGTGCGGCATCATCTCCATGAGCAGCGTGGGG
TACGCGGCGTCCGTCCCGTCTTCGATCttgctgaagtcgaagtaGATGCTCGCAATGATGCCCGGGATCACAATCAGAAACGGAGGAAGCACCTTGAGCA
TACTGGCGAAGGAGCAACCAGCCTTGGCGTTAGCCGTGTCCTTGGCCGACAACACACGCTGCACCAAGTCTTGGTCCATGCACCAGTACCAGATTGAACC
AAGCGGCTGGCCGAAGATCATACCCGTCCACGGGTAGTCCGCATCATCCGTCGGCTTCCACAGGTGGAACCAGCCGGAGCGGTCCTGGTTCGCCAGGTTC
GCTTTGATCCcctcgaagccgccgatCTGGTTCGTCGAGTACGAGAACACCACGAGACCTCCGAGCGTGAAGACGCACATTTGGAACAGGTCCGTGTACA
TGACAGCACGCAGGCCGCCGGCAATGCTGTACATGGCACTGAGGGCGATGCACACGCCGGCACCGAGGTACAGGTTCCATCCGAGCGTCGCCTGGAAGAC
GATGGCCCCACCGTAGATACTGGCGCTCATCTTGGTCAAGACGTACATGATGATCGTGATGAGCGACAAGTAGTGGCGGCACGGGGCTCCGAAGCGGTAT
TCGAGGAACTCCGGGGTCGTGTACACGCCGCAGCGCCGGTAAATGGGCGAGAAGATCCAGCCCAGGCAGAGGATCAAGATGGCGGCGTACCACTCGTACA
TGGCCACTGCAATGCCGCGACGGGCTCCGTCGCCGGCCATGCCGATGAAGTGCTCAGCACCAATGTTGCTCGCGAACAGGGCCCCGCCCACGAAGTACCA
TTGCATGCCGCGGTCGGCCAGGAAGAAGTTGGACACGTCGTTCATCTGGTGCCCCGGGCCGTCCCGCGCCATGAGCGAGGCCGATGGGCGGTTCTGCGAG
AGCGTTGAACCACGCTCGTCACCGTCGGGTAGTTTCTTGCCCGGGGTGGTCTCTGCGGCCAGGTAGGCGTCTCCGGGCGACTCGAGCACTTGCTCTTCGT
TGCGCTTGGCTCGGTGGATGCACGGGAAGTACTTGGCCAAGTGGCTCTCGCCGGCTTGGATGGAGGCGATGACGGCCACGACcatcgtgaagaagagcac
ggTCACGATGACGAGGATGTCGGCCCAATTGACCTTGGCACCTCCGGACGTCTCGGGCACCCTCTGAGTGAAGAGCTCGACCATGGCCGACAGGAAAGGA
AACCTTGGCTTGGACGTGCGCCCCAGGCGGTGGATTCGATAATGAACTGGACTCGAGCG