Description :
From Genome Similarity Track
Location :
Scaffold_13:352413- 355224
Sequence
2811 bases(100 bases per row)
GTACCGCTTAAGAGGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAT
ATATACTTAAGTTTCATCTTTCTTGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGCTTTCCGATCCTCTCCCCCACTTAGAATAG
AGGAGTCAGTGTCTTCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTT
GAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCTGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCT
GTTTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGCAAAGGGAGCAGCGCTTTCCAAAGCGCAGCAGTGAACCGCGGGT
CTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTGACGGGGACTGG
AGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATC
GACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGATTGACCCGCTGACATGTTTCGCATGTCTTAACGTACC
GTGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCAGCTGGAGGGCGCGTCATGCGC
CTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCTGTGGAGGATCAGTGGGCTCCACCCGTTAATAGAGGAGACCCTCTTTAAAC
TCATATCGGTCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCTGTGGAGGATCAGTGGGCTCCACCCGTTAATAGAGGAGACCCTC
TTTAAACCCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCATAAGGAACTTGACGATAGGCGTGACA
GCTTTATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCAGGACGCCGAGAGAGGGCGT
CCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGAGAGAGGTGAGGCGA
GTTAGCCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGACCACGAAACTTCACAAGGGCATATTTCATTGCC
AGGAGCTCCTTGTCGTGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCA
GCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGGCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGC
CTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGACTCGACAAGGGCTTAGCGAAGCCCGCGTACCCT
GCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTG
GGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTATTCTCTGGTGACGCGAAAACGCACTTGTCGATATTGGCGTAGAGCTTGTTCGC
TCGCATTACGTCCAACACTCGACGGAGGTGTCCTAGGTGCACCTCCATGGCCGTCTTGCCTCCTTCGGCACGGCTATGGACGAATATGTCGTCGAAGTAC
GTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCC
AAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTGCAG
TACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCATCTTGTTATAAGCGTGAACCAGA
CGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGG
CATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGTCGTACGCCTCGATC
CGGTGGGAGTT