Description :
From Genome Similarity Track
Location :
Scaffold_45:352364- 358189
Transcript NameFunction/comments
Physo_136400reverse transcriptase
Physo_108947putative polyprotein

Sequence
5825 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATG
GAGCAGTTCGCTCACTTGCCCCCGAACCAGCAGGATGTGCTTAAAAACCTTATGTCCTTGCTGGGGTGACGCAACTTGCGCAGCAAGGCTCCGACGCGGT
GAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCTCTAAGCGCCCGCTTCG
TCATCCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGTGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGATTGATGCTTTGGACCCGTGAGGTTG
AGATGGCTATGAGCTCAGCTCCACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTACCTGCTACCTCGAAGCTCGGTGGGCGAGAGAGAGAGTGGGCAC
TAACGTCCGGGACGTCGTTCGAGGTGGCCTTCCCGACATGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGTCTAACGAGGCGTATCGCGT
GCGCTCACGTTTCCTGGCGACCAGGCAGAGCAAGAAGGAGTTCATGGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGTATGTCTGCGGACCCCCTG
CCGGAGGCAGTCACCGTTACGGTGTTCATGGAGGGCCTCCGCACTGGCGTTGCCAGGACGGAAGTGTTCCAAACCCACCCGAGCTCTTTCGGAGAGGCTG
TGAGCGTCGCATTGAATGCGGAGCACAACTTTAAGTCGTCGAGACTTGGGTGGAATGTGTCTTACGCTAGCGGGTCGACTGGTCCGGAACCCATGGGCCT
CAGCTATGTTGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGGGCT
AGGTGTCCGCTGCGCCATCAGCGCCAGGCTTCTCCAATCCGCTCTTCGAGTTCGAGCCAGGGCTCTGGTTTGTCTCGGGGAAACGAGAAGTCCCAGTAGG
CGCGGGGCGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAACACG
GAACGTGTATGCAAGACGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACGAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTAGCT
ACGCCCGACATTCCACGATGGACGGAAGTCAGCTTTATGATGAGGCGCTGGAAGCGCGCGGGAATGACATCGTCACTGTTCGTCTCGCGACAGGCACTCG
TGTCACGGTGCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGAT
CTCATCCTTGGCATGGCGTGGCTGGAACGCCATGAGTCTTGGATCGATTGGAGGCGGAAGACCCTTGATGCTACGCACTTCTCTCCTGGCGGAGCATTGG
CGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTCTGGCGCGAGCACTGGACTGAGTTGGTCAATGTGCTGGACATCGGAGTTTCCGAGTTGGT
GGACACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGTGGCTTGCGGACGGCAGGTGGGGCGGCACGAATTCCGATGAGCGGGTGTGCGTCTGAGGGCGAC
GCCCTGCTGTGTGCCAGCGACGGCGCGGTCGGCACGATGCCGAAGGACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGTAATCCACTGAGTG
CAGGCTGCGGATCGTGCAGCTCTTCGCTGAGTGTCGGTAAAGACACTGGAGCTCCCCTGGAGCTGAACGAGGTGGTGACACCTGGCACCAAGACGCACGC
GAAATCACGGAGCTCTTCAGCGCGGAAGGGGTCCATGAAGAGGAGGCAGCGCCGCAAAGTGCTGGCTGCGAGACGCAAGGCGTCTGCGATCTCATGAGTC
GAGAAGGGCGTGTCGAGCGGTGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACACGCGACGTCGACGGAGGTATCGACCTCG
ACGACTTGCCCTCACTGTCTGCTCTCCTGGAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCCGAGGTAGTGGT
CATACGACCCGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACAAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCAATC
CTGAAGAACCCGTCGGATCCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCAAGGTGTTC
GACACGAAATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACTTCATTGACGCGTTCTTCCGTGC
GAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGTCGTATCGTGCATGCT
TTCAACAAGCTGAATGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTCCACAACAACATGACAGGATGTACGATGTACAGTGCGC
TCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATTTCTCTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGT
GATGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGAAATTCGATGAC
ATCTTTGTCCACAGTCGTGCGGAGCACGGAAGGACTGATATGGATAACCATGTGGGGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGT
ACGCCAACATAGACAAATGCATCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAA
GGCCATTGTTGACTGGCCGGTTCCCAAGAAGTAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAG
ATGGCTCAGCCACTCTCCAATCTCCTGAAGAAGGATACGGAGTGGTGTTGGGACATCGAGCATCAAGATGCGTTCGTGGCAATTAAGGACAGTCTCCTTC
ATGCACCTATTTTGGCTCTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTGCCGTCGGCTGTGCCCTGCTGCAAGCAGACGC
CGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTACGGAGAAGAACTGTCTTGTCCATGACAAAGAGCTACTTGCGATGAAGTAT
GCGCTCGTCAAGTTCAGGGTGCATCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTTT
CGCAAAGGATGGCCCGTTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAGGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTGTCGCG
CAGGCCGGATTATGAGCTGGTTCATGTAACGACCGTGACTTCGTCATTACCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCGCTG
CTGAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGT
TGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGGTCATCCCTCATGACGAGGAACTGAAGTACCGCATCCTATATGAGGCACACGACATGCCGCT
GGCCGGCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTATTGGTGGCCGAAGCTGTACAAGTGGGCGAGCACTTATGCGCGCACGTGC
GAGACGTGTCAGCGAGTGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGGGAGTTTGTCTGTCCCTTCGGGCTGTTGGCAATCCATGAGTATGGACTTTG
TGTTTGGCCTGCCGGCGGGCGCGGCGGTCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGATCACATTGCGGCTGTGCCGGATACCAT
CGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGGC
AACTTCTGGAGCGCGGTGCTTAGCACCAAGCTGGACATGTCCACTGCGGACCATCCGCAGACCGATGGTCAGACCGAGCGCGTAAATCGCGTCGTCGAGG
ACGTGCTCCGCAGCATTTGCGCTGACACGCCGAAGTGCTGGAGCGCCATGCTGCCACTCGTTAAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGG
CTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGACCTCGGGCTTGGTGGGGGAGGAGAAGCCGACTTA
GCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTCGACGCGTCTGAGTGTCTTACGACATGTGCGTGACGCAATG
GCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCTAAGA
ACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCAGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACAC
GCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGATGGAGGCACCGAGG
ATGACGAGGTCACAGGCACGGAGGTCGCGGTCGTCGAGGACGCGACCATCCACGCGGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCGC
GGGCACAGCGAGAGCCGCAGGCGCAGGAGGCGCGGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAACACAGCCTGGTGACTCTGT
AGCTCCCCGAGCTCCCGGCCACGTTGCTCATTGCGATCGCGATAGTATCGCACCCAGTCCTCAGTGCCCCAAGGCGGTCTTAGACCGCTCGAGGCACCTC
GATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGCCCAGACGTGCATCAACGTCATGGATATGATCCCGAAGGCAACTCGCCTGC
TGCCGCACCTCCAAGAGCTCACTTTGAGTCGCAAAGATCCCCACAGCGGCCTCCACCGGCCCTGCTCGATGAGCATGGGAATTTACATTACCATGTGGAG
CGCCTCCTGGCTAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAAGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCC
TCCGCCAAGACTGCCCAGACGTCGT