Description :
From Genome Similarity Track
Location :
Scaffold_574:3523- 7587
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_574-snap-gene-0.5Poly [ADP-ribose] polymerase 2
Pytul_var.sporangiiferummaker-pug3_contig_574-snap-gene-0.7CAAX prenyl protease 1

Sequence
4064 bases(100 bases per row)
CCATCGGTGCTCTCGCCGCCGCTCAAGAAGCGCATGCACACGCGCAGCGACGCGCGCGCCGTCAAGACCCAGTCGTTTGAGGATAACGACGACGAGTACG
GTGAAGAGGAGCGTCTGGACGACGGTGCGCACCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCACCTACCGGACCCGTACAAGCGCCA
CGCGAAGGTGCTCCAGCACAAAGGCTCAGTCTACGACGCGATGCTCACGCGCGTAAGCTACCCGCGCTGTTGTGTTTGTGTTTGTTAGCGAGCCGCTTAT
ATGGTGCATATCTCTGCTTCCACCTTCCATTCATTAGGCGCGTGTGCATCAGAACCAGAGCGAGTTCATTGCGCTGCAGGCGCTCGAGTACGGCAACCAG
TTCTACCTCTGGATGCGCTCGGGCACCATCGGTCTGCCGGGCAAGACATCGCTCACGGGGCCCTACGAATGCCACGAGAAGATCATTTTGGAGTTCTGCA
TGGTGTTCTCATCCAAAACGTGCTGCACGTGGGAAGAGCGCCACTCGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGGCAGGTGCG
TGTTGCCGTTTTGCGTTTATGAGCAAGTTCCAATGCCACAGCGGTGAATGAGATGTTCACGTGGGGGAATGATATCCTTGTGTCTGTGTGTGAGCAGCTA
CACGTGGATTGAGCTGGACTACTCGATGGGGACGCCCTACGCCGACGTCTCGAGCTCGTTTGTAGACAGCGTGAGCGATTGCGACGATGCCGCAAGCACA
GCGACAAGCACGAGCCACGACGCGCGCGGCTACAAGCGCCGAAGAAAGAGCTCTTCGCTTGCGTCGTCCAGATACGCGACGGCGATGAACGAATGGGTGT
TGCCGAGTGGCGGAAGCAGTCGCACGACGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGATAGTAGCATTAGCAAGAATCCCAACA
ATGCGCCAAAGTTCCAGCGGCCCGCGTCACGTTTGCATGCAGAAGTCCAGGCGTTCCTCTCGCTCATCGCCGACCCGAGCGACTACCTTTCGTACAGCTA
CTCAGAGACGGAAGAAGTGATGGAAGAAGCCCAGAAGATGCCACTCGGACGGCTCTCCAAGACCACGATCAAGCGGGTAAATGTGGCGTTGCTTGTATAG
CTCCTATTTGTGGACGTTGTGGTCGCCAACAGTGCTGCTGTAATATCTGTAGGGCTACGAAACGCTTCAGGAGATTTACGAAGCTCTGCGCAGTCGCACG
GCGCCGCGAAGCCAGATTTTGAACTTGAGCAGCCATTTCTACTCTATCATCCCGCACCACTCGCGGCTCGAGATCATCGACACGATGGTGAAGCTTGGCA
AGAAGGTTGCAATGATGGAGAGCGTGTGCGAGAACGTGCGCGGCATGAGCAGCATGGAGATCGCGAATCTGTGCCACCAGCGCAACTACCTGGACGAATG
CTATGAGCTGTTGGACTGCACGCTGCACCCTCTGTCGGAGCACTCGGACGAGTACGCACTGGTGAAGACGTACATGAAGAACTCGAGCTGCTGCGGCTGG
AAGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAACCCAGCGAAGATCGACGTTTTGAGCCCTACCGCGCATTC
AGCAACCGAAAGGTACGTTTCCCCCTTGCATTAGTGTGGAGCACAAGTGCTTGCAACAGGCTCATGACTGGGTCATGTGGTGTTTTATTTTTTCCAGATT
TTGTGGCATGGCAGTCGATTGAGCAACTGGCTGGGGATTTTGTCGGACGGACTGCGGATCGCGCCACCCGAAGTCGCGTCGAACGGTCGCATCTTCGGTA
AGGGCGTCTATTTCACGGACAAGGCGTCCAAGGCGCAGGCGTACTGCCACGCGAGCGCGCGCCACGGCGGCCAGAACAAGTGCATCTTCGTGCTGAGCGA
GGTGGCACTGGGCGACGTCAAGGAGATGACGGCATCAGACGAGCACGCCAAGCAGTGGGTCCACNNNNNNNNNNCCAAGTCGTCGTACTTCCACAGCTGC
AAGGGCGTGGGTACGTGCCGCCCCGACGAAAGCGGCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGACGGCGCCATTTGGCCACTGG
GCAAGCCCACGCAGGCCACCGAGGCCACGGGCCTGAGCCACTCGGAGTATATCATCTACAACCCCGCGCAGGCGCGGATGCGCTACGTCGTGCTTGCCAA
GAGCGCGTACTAAACGCCTTTCTTAGACGCCACTCTCCTGCTCTCCATTGCGTCTTGGCTGTATGTTTTGAATGTGTATTATGCGTATGTATGCGTTTGC
GGGGGTTTCTGTGTGGTTAAAACGCATAAAGCTGGTGCAATTGTGAATATGTTTATTGGCATATTGTCGCTTGGTTCTCATTGTATCCATATAGACCATT
CTGCAGCTTTACTGGGTCTTCTTGGCGCGGTCATTGGCACGGACCGAAATCGCGTTCAAGCGCTCGACGAGTGGCGGGTGGCTGTAATGGTACGCGCTGT
AGAGCGCATCCGGGTTCATGTTGGACAGGTTCTCGATCGCGAGCTTGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCGGTCGTGGCCC
AGGTCCACGGCGAACGCGTCGGCCTGGAACTCGTTCTTGCGCGTGTTGAGCGTGATCAGGAACGACAGCACGTGCTCCACGGGCGCCCACACCGTCTGCG
AGAAGAGCAGGAAGCCGATGATCACGGGCTTGGTGTCGCTCGCGAACCCGAAGCTCGCAAACAGCTCGCTGTCGTGCATGCACAGCCCGAAGACGTAGAA
GAGCACGAACGTGTACACCTGCTGGATCACGAAGCCCTGCGCCGTATGCCAGAGCTTCCAGTGGCCCAATTCGTGGCCGAGAATGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGAAGAGCACGATGCGCTTGCTCTTGAAGAAGCCGAAAAAGTACGCGTTGCTGTGGTTT
GACCGCTTCGAGCCGTCGCATACGAACAGCTTCGTGAGAGGAAAGTGCAGCGACGACGCCAGTGCTTCAATGCGCGAGCGCAATTCCCCTTCCTCCAGCG
GCGTAAACTTGTTGAACAGCGGCATGATGAGCACCGGATACAGCGTGACCATGATGAGCGAGAACGCGAACAGGAACGCCCACACGTACAGGTAGAACAG
CTCGCCGCCCCATCGGATCACGTAGATCAGCGCTGCTGTCACTGGGTACCCGATCACCATGAACAGCACGAAGCCCTTCAGCTTGTCCATGAAGAACAGC
CCGAGCGTCTGCTTATTGAACCCATGGCGCGCTTCGACCACGAACGTCGAGTACAGCGCAAAGGGCAACCCGAACAACGTGTCACGGATCGACGTGAGCG
TGAGCAGCATGAGCGCCAGGTAGATCTCGTTATGCGCATCCAACCCGACCGCCTCGAGCGCACGGCCACTTACAGTCCACATGAACGGTAGGTACCCCAA
AAAGAGGAACGCTGTCGCTTCCAATTGCGAGTACGCACCAGACACGAACGCAAACGTGCTCTTATCGAGACCGTACGCGCGGCTCTTGTCGAATTTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCAGCAGCGAGATCGGCTTTGCCGGCTCCTCAGACTCCTTCTTTCCGTCATTGTCGTCTTGCT
TGTCCGCATCGCCCTCGTGCTTCTTTTTCTTGGGTGTGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGC
TGGCGGAAGTCCAGATACGTCTCGAACGCGTACACGACCGTGATGAACACGATCGACGCCTGGAAGTACGGCACCGATCCCGGCTGCCACCCCGGCTGCG
TGAAGTACGGCGCGCTCCACCACGAGTGTTCTTCGGCCATCGGAGCTGCTGGAAATGGTGACAA