Description :
From Genome Similarity Track
Location :
scaffold_13:352213- 353675
Sequence
1462 bases(100 bases per row)
GATCAGGGGAAAGTCTAAGCTACCAATGATGGCTTGTTTCAAACAATGTGAAACAGCTGAGACGATAATTAGGCCCGACCAACTATTTGCATAAATACAC
GCGCAAATCTGCAGCGTTGGTGCAGCCCCAAACGACTCTTTAAAGAAAATTCTTTAAAGAGTCGTTTTAAGCGGGAATGATCGAAAGATCACCGGGTGCT
GGTTGCCGAAGTGAAGGAGAAGTTGAGAGAAGACTCTGTCATTGTGATTGCAAACCACGATTTACCTTTTCATGTGGTCTGAGATGCAAGTGATTACGCA
ATCGGTTGTGGGTTGATGCAACATGATGGTGAGGGTTGTGAGTGAGCTGTTATGTATCAGTCGCGACAACCGGGGTTGTCGCGACTGTCTACTTGCTCGG
GGAGAAGTGCTTTGcaatctatacagatcaatCATCGCTGCGTACGGTAGTAAAGACTCCTATTTCATCGCGGAGAATGGCTCGATGATTtaatttttgc
aaaatacaTTTCGTTGAACACAACATACCAGGTTGGACAAACATCTTAGCCGACGCGCTGTCCTGACGTCCGGATTATGATCCAAAGTCCGGGAGCGAAA
GCATACACGAGTCATGTCGATAATGCGAGGATTTATAGACGATCATAGTGCAAGCAACGACTACGGTGcgcaaagaaattgtcaaagGGCAAAAATCTGA
TTAGACGTCAGGACTTGTTGAAGTATAATAAAGACCTTTCGACAAAACACTGCAAGGTCTTCCGTCTCGCACAAGATCGCGTGTTCACCGTTTTGGGACA
CACAATGCATTGTTGTACTATACGGTTGAACGCGGAAATATAGCAAGAGTTGTTGTTTTAAATAAAGAAGGTTTGTGTCATCGTCTCTTATATGAGTACC
ATTACAGCTCTTCGATTGGTCATCTCggacgtgagaaaacgtttcTCATTTACCCAGGGTTACTATTGGCCACACACGTATATGTGAGTGCTTAAGTATA
TGAGGACTTGTGATATTTGCCAGAATATGGAGCCATCGAGTTCTACCCAAGCCCCTATTCGGACATTGGGCAGTGCCAACTGACGTCTGGAAATTTATAA
GTATGGACTTCATATTCTGACTTCTACATGACTAACATGAACGCAGTGGTAGTGGGCTAATTTAGCAAAATGGTTCATTGTGCGCCATATTCGGGTAAGA
TCTCTGCCAAGAAAGCAGCTAAGATCCTTGAAGACGTTGTTTTCCGTCTGTATGGCCTTCCTGTTGAGATCGTGTCTGACCGTAACATCTGTTTCAAGTC
AAAATTTTGGCGTGCACTGTTTGGACAACTGGGCACCAAATTGTCCAAGTCAACAGCAGTGCACCCTGAAACGGACGGTCGAGCAGAGCGTATAAATCGA
GTCCTGGAGGACGTACTGCTTAGTAACGCTACGTTGTTCAGAGAGTCGAGTAATTATTTCCC