Description :
From Genome Similarity Track
Location :
Scaffold_102:35215- 39894
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_102-abinit-gene-0.49Striatin-3 family protein
Pytve_DAOMBR484maker-pve_contig_102-snap-gene-0.22Vacuolar protein sorting-associated protein

Sequence
4679 bases(100 bases per row)
TCTGCAAACACAGCGACACTCCCGAATCAATTTCTCCGCCTCAACAAGACAAAGACGATCGGTGCTCAGTATGCGTACCGGAAGTAACCGCCCACGTTCG
CACGACGCCATCCGCTCCAGACGAAAACAACACATTCGAGAGCGGGTGGGCGTGGAGATCCCAAACTGCATCCTCGTGAGCACGCTGAATCGAATGAGAC
TTCAGCCCTTGATAGTCTTCATACGTATAAGGTTCGCTCCCTTTCTCGTTGTCGAGGCCAGGCAACTTGAACAAACAGATCGACCCGTCACGACCCGACG
TCGCGAACGATCCGATGCTCCCTGAAGACGGGTTCGGGGTGTTTTCAGAGCTCATAATAGCGACGGCCAACACGCTTTGAGCGTGCGCTCGCATGGTCAG
CATCGAGTCAACCTCTGCCGTCCTGTTGTATGTTGACACATTGCATTCGTCAGTACAGGGACTTGTGCAATGTCTGTGGTAATGGCATCGTACCGTTGCG
ACGGAGGACCGCTAGACACGCTGGAAAGGTTCCAGATTCGAACCGAGCAATCCTCACTGCCCGACACCAGCAATGGTTCTGTCGGGTGGAACGCAATGGA
CCGCACGCCATCCTAACAGACAACGCGATGTTAACATTCTCGACCTGCTTCAATTGTATTGTGATTGACCACGTACCATGTGGCCCGACAGCTTGAGCTT
GAGCTTGTGCGGCCGGTAAGATCCTTTCGGGGCGATATTGATCGCGACCGGCTTGACCGGCTTGGCCGAATCGCTCACATCTTCATGAGCAGACGCCGTC
CGGGATGGTATCCGAGGTCGACTGATCTCCGTCCCCGACCCATGCGCACTCTTCCCCGAACCGGTTTTCACCGAATTCACGCTGTCGGCTCGATAAATAT
TGATCGACTTGGGACTCGTCGCTGGCGACGGCATCGGCGAGTGGCCAGAGTGCGCCGACTTGGACCGCTCCATCGAGCGCGTCACCGTCACGCTGCGGCT
CACCTCCGTGCTCGCCGTCCGTGATTTAGGGATCCCGCTCGAGATTGGGGTGCTGACTGGAGCAGGTGAGATGAGGTACCGTCCCCGCTCCTGGATTTGA
GCCATGGCCGGTTAGCAAATGCGTGCGCTGCACAATAGCAGAAATGTAGTCCGCACCTGGCGCAGCGCGAACTCGAGCATCTTCACCCGCAGCATGGCGT
CCTTGTAGGCGTCCTCCTGGATGCTTCTTTCATTCTCCAGCTCGCGTACGCGCTGCTGGAGCTGCTGCCGCTCATCGTTCCACTGCGATTCCTCGTGCGC
GACGCTCGCAAACTGACGCTGCAGATACCGCAGCGCGCTGTCCACACTATCCATCGGCGCTCCGCCTCAGCTTCTGTGCGCCACAGCCACGCGATCGGCT
GTTAGACCTTCTCATGCCCTCCTGCGCCTCAAAAACACCGCGAGCTCGACCTCACCTTGAACGCCTCGTTTCGCCGCGGCTCAACGTCCGCCCGCGCTCA
CTTCAGATCCCCGACTCGCTACACTGGAGCGCCGTATAACGTGCTGAGCGGATGAGACGACCGCGCGCTCCCTGTCGCCTCCAGCTCCGCGCTTGTCACC
GCCAAAGCGCCGGCAAAGGCTCGGGCTTCTTCTTCCCCGGCCTGTGTTATCGAGGGTTGCCGCCGCTCCCTCGTCCGAGAGTTTACGCTCTGGACCGAAA
AACCCCAAAACCTCGGGCGGCGGTCGCTTGAAGTGAGCGGCACCCTTTTACGCTGCATGGATAACGTGGGCCACACTATAGTACCTCGTGATGACCATCG
GAAATCCCAACAACCACAAGAGGCAAAGGGCAAGCACGCGCTGGTCTCGCGGCCACGACGCCGCTTTCCCTGCGAGCGTGTGGCGTCCCCGCGCGCTGGC
CGCGGTTAGAGGCCGGCCATGTTCGAGACGCTGGTGACGCGGCTGCTGACCAACGCGCTGGGCAACGTCATCGACCCTAAATGCTTCAGCGGCGACAAGA
TCAATGTGGCCGTCTGGTCCGGTTATGTGGTGCTGCACGAGCTCGAGATCAAGCCGGAGGTGCTGGACCACCCGGCGCTGCGGCTCGTGCGCGGCATGGT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCAAGATCCCGTGGAACCGTCTCCAGTCCGATTCGGTGGTCGCCACGGTCGACGATGTGTACTTGCTG
GTCCACACCGAGGCGGATGTGGAGGCTGTCATGCGCGCCATGGACGAGTTCACGATCAAGAAGAAGCTGCTGGAGAGTCTGTACCTCCAGGCGAAGCAAC
AGGACAAGGATGAGGATGATGATGCGTCGGAGAATGGCTTTGCCGCGCGCTTGATCAACAAGATCATCGACAATGTGGAGGTGAGCTGGTGTTGCCATGC
TTGAATGGCAGTACCATGCGAATACGAGCGCTGACGCGTAGCTCATGCTACTGTAATGTTGGTGTCATATTGTTGATGCAGTTGCACATTCGGAGGATCC
ACGTGCGCATCGAAGATCATCATTCCGGCGACCACCCGTTTGCTATGGGTCTGACAATCGAATCTGTTCACGTTCAGGTGGGAGAAATGAACTCGCGGCG
GTTAATTGACATCACGACTGACCGATTCTGTTCGTCACTGTGCAGTCTACGAACTCCAACTGGCAGCCGTCGTACGTTGATACGTCCGTGAGCAACGAGC
CACGGATATTCAAGGTCGTCGAACTGAACCACTTGAGCGTGTATCTGAACCCAGACTGCGATGTTATCCACGACCACAAGATCGACTTCAAGGCGTGCTC
GCTGGGAGAATTTTCAAGCGCATTCAGCCGATCAATCCCGAAACGATTTGACGATCGGCACTTCCAGCAATTCCAGCTCTACCCGCCTCACCAGCAGCAT
CACTTTTTGCTGAAGCCCATTGACGCCAGTGCTCGTCTGATTGTGAATCGTGACGTGTCCGATTCTGGGATGCCCCGAGTTGAAGTCGACGTGAGTATTC
CTGAGGTTGCTCTCCGCCTCGAGGAGTCCCAGTACTGCGATTTGCTGTACCTGGTGGCGGCGTTACAGGTTCCAGACCACTATGCGAAGTATCAGCCGTA
TCGCAAGTTCCGTCCAAGTGATTCCGTGTTCGAGGCAAGACCCGGCGAATGGTGGAACTACGCAATCAACGCGGTCATGAGCGATGTGAGAGATAAGCAA
CGACGCTGGTCGTGGTCTTATATGAGCAAGCGTCGAACGGATCGCAAGAAGTATGTGAGGCTATGGGTGCAGCGGGCTAGAAGGCGGTTGGAGCAGGAAA
GTGGGGGAACCGTATTCTCGGATACCGAAGATGAGCTTGGCGAGCGTAATGACGATGTGCTCGATGACAGCAATGATCTAGACGGAACCTTTCAATCGCC
GATATCTGAAGAAGACTTCCCTGAGAGTCAGTATGAGCTACCAGAGCTCGAGAAGGCGTTGGAAGATATTGAACGCCGTCGCACTGTGGAGGACATCCTC
TTCTTTCGGTTCTTGGGGGACGCAGAGGTTCGCAAGTCCGGACATTTTCTTCAGCCGAGACCGACTCTGGCGCCTCCACCGATGCACAATAGCGCCGCTT
CGGATACCGAGTCTGTTGATACGGAGGTGACCGGGTCAAGTGCTCCGACCGAAGAGAAGTTCCGGACGTGGGGTGCGTGGATGTTCGGATGGACATCGAA
GTTGGCAGTGCCGCCACCAACTGGCCAAAGTGATGATGTTCCCCAGCGTGTCCTGCCGGATGTCGAGATGCGAGAACTGTTCAAAATATTGGAGTATGAG
CCAGTTAAACGTGCAAAGAAACGGCTGCACCAAAAGAATCGAGACGACGCATCGGATCACGGCGACGAGCACTCGGAGACAGACATCAATGAACTTCTTC
GTGTGACTGTGAGTTTGCAGCGCGGATCGCTTTCTTTAGCGAGTGATCCAGAGACGAACCGCACTTTGGCCCGCGACGACGGCAATTACGGCAGGAAATA
TGCGCCATCGGATTTCCTGTTGGGGACATTCTCGCAGCTCCAGATCGCGGGTGTCGTAAGAGATGATACCGTGGCGTTCGATTTGTCGCTGCAGTCAATC
GAAGCGTTTGATGAAAGCGCGGAGAGCTCCCTGTTTTCTCGCCTGCTGAGTCGCAAGCAGACGTTTCGTCCCGGACCGGACAATGATGAAAACAGTGTCG
GCAAGCTGTCCGGAGTTGTCTTCTTGATGAGCTTCGAGACGAACCCCGCGAATTCGAGTGCGGATGCAGCTCTTTTTGTGCACATGGAGCCTCTCGAGAT
AGTGTTCTCGCCAACAGCGCGGTGCTGGGGACGTCTCGCTAGTTTCCTGGATACACCGAAAGCACTAGGCTTGTGGGCCGAGCTGGAGGTGGCCTCGTTC
AACGCGATCGTGAATCTCAAGGCTCGAACCGAAGCGAAGTTGAACTATGTTCTCGCCAATCGCCTTGCCATGTCTGTCGATCTCCGGATCCAAGCCCCGA
TAATTATCATCCCGGAGAGCGACACGGATTACGACTGCTCCCGTCTCATTGTTGATTTGGGACACATCAATTTTCGGACTGATCGACTCAGCCAGTTGGA
TAACGATACGATCAACTTCAACCCCGCAAGCACGGCGTCGCTGGGCAGATCGGGTTTATCATCGCTCGCGCTCATGACT