Description :
From Genome Similarity Track
Location :
Scaffold_100:3520- 4843
Sequence
1323 bases(100 bases per row)
CCTCCCCCCCCTTGGGTTAGTGTCATACTCTAAATGGGTGGGTAGGCGTGGATGGCGTAAGCCGTTCACGAAAAACGGTGTATGCGCTGTCGATGCATGC
ACGGGGTTGTTGATTGCAAACTCCACCATCGGAAAAATTCGCTCCAATCTGTGAAAGATTGGACCTATCTTTAAAGGGTATCTTTGAGGACTCGGCTGAA
GCGTTCTGTTTGACCATAAGTCTCGGGATGGTCAGAAGTGGGACATAGTCAGACGTGAACCAAGGATCTCTATCAGAGACTAGTTCACGGGGTAGACCCT
GGAGTCGGAATACCGTGTCAATGAAGACACGGACACAACCATGTGATGAGATTGACTCATTAACTGTAGCAAAATGTACCATCTTGCTGAATCGGTCTAC
GAACAGAATAATACTGTTATTCTTGTGAGCGTCTTCAGGTAAACCGAAGACGAAGTCCATTGAAACGGCTACTAGCACTCTGCCAGGATTGGTAGAGGAA
TGACTAAACTTCACCCGTTGGCACACTTCACAAGCACGGATGTACTTGCGCCCAAACTGATACTGGAGGGCCAGTAAAAATCTCAACTTACCGTGAGATA
TTTCTTCTCACTCCCACGATGCCCACTAGGTGGTGCATCATGGCACTCATGCAAGGTGCGCAAATAATTATGAGTGGGGAAGACGACACGAGGTGTGTCG
CCAGCAGCGGCTGTATAATACATCAAACCCGTTGCGTGTTGTGTATCGATCCGCGGAAGATTGATACAAGGCCGGTAAATCTTTGAGAGATTTACGAGAT
AAAGTCGCCAGATGATCCATTAGTCGCAGAAGAGCCTTATCTTCTGCGCAGACCTTTTTTATGTCGTCAAGCAACATTGATGACGGAACACTAGTGACTA
GTGTTGCAACAGTGGTATCAACCTCATTGTTGGACTGCACAGACGACTCGAATTCAGGTCGGCGCGACGACATTGAGTCGTCCGGGTTTATACTCTACGG
AGAGTTGTACTACTCAAAGAAGGACAGCCACATCGCCATTATTTGCGAGAGGTGTGGGCTGTTTAAGGCCGTTCGTAATGACGCATGGTCCGTACAGACT
ACGAACGGCCTATATCCAAGGATATAGACGAGAAACTTCGCTAGTGCATACTTCATGGCAAGGAGTTCCTTGTCTACACTGGATAATTACGCTCAGTTGC
TTGCAGCTGACACGATTGATAACAGACGACGCGCTCTGCGCCGTCCGCATCGTAATGCATCAACGCGCAACCGATTGCGAAATCGCTGGCGTCACAGACC
ACATGGAATGGTCTGTCTTGGTC