Description :
From Genome Similarity Track
Location :
Scaffold_457:352- 4402
Sequence
4050 bases(100 bases per row)
TACCGGTAGTGTTAAAACCTTAATTGGGGTGGTGGCAATACCCAACCGTGACTCCGTGGTGGACGGCCGTCAGTCATTTACATCACGATGAGATGCCTAG
TGCTGCAGTCATTATGAATCCACCCACCACCTTCATCGGCAGTGACGGTGGTCCAAGAATTCGTGATGTTACAGGGTAGAAACCGATAAATATGTGGTGA
AATTCCCACCGTAAACAGCCGTAACCAAAGGCTTATTGGGGCTGCCTGGTACGGACACAGCAGTAGTTGTCAGCATAAGTCAATGATCGTCAGTTAAATA
GAGAAATGATCTCTCTTATACGCTGTATCTATCCGCGCAACTTGTTAAATTTCCGTCTAAGCCAGATAATCGAAAGAGAAAAAATCTACAAACGTCTAGG
ATTGTTAAACGTGTAAACCTGCCCCATTCTCTTGTCGTAGAATGCCGAGTATCGGGTTACAATCGATTTTTCCAACGTGTCAGCAGAAGCCTCTTTACTT
TGAGCACCTTCAAGTAAATATCCTTTGGCTTTATATTGTTGTCGAACCATCGACTGAACAGGGCCTTCCGGTATCTCAAGGCGGCTGAGGCCGATGAGTG
CACGCTTTCCGAGTCTGCGGTGTCCAGTGCCTTGATGACGACACGAGCAAGCTGGCCATCTCCGCCAAACCTATTTTGCAGCACGGCGAACACATTTGTT
TGATGCTGGGGATTTATGGCGTTCAATAGAGCGACAAATTCTCCCAATGCCGCAAAAGTTTGGCCCTTCGTGGGCGAGAAATCATCCGATTCAATCTTCA
GTAGCGAGAAAACGTCGTCCGCAGATTTCTCGTTTTCTAACCACCAGGCCAACTGCTTTCTCTGCAGGTTTACAACTAGACTGTCAATGCGTGAGTCGTC
TCTGTTAATATAAAGCGCATTCACCACTTCTTTATCTCCGTAATGGGCAGACAGTGTCCCGATCAGCGATGTCTTACGGTTTGGATTCCTTGCGTTGTAC
ACGGGAATGTACGTGCTCAACGTGACCAGGTTTGTGTCGGCAAGGACGTCCTCCATACCACGGTCCAGTCGGAGGTTCTTCAAGAGCATTTCTGGGTCAA
TATTGCGCTGAAGCCATTGGTTAAACAGTGCCGTCTGAAACGATCTGGCCGCGCTTCCTGGGACTACTTCCAACTGTGCTTTCACCAAAAACTTTGCGTA
TTCTCTTTCTCCACCGAAGCCGTTTGTCATAACCTTGAGTAGAGATTCATCAGCAGATTTCTCACGGTTAAATGCCTTAATGTAATCTTTCAAGGCGCCC
AGCTTAGGGCTCATTAAAGCCATGAACCCGTCACCACGCAGGTTTAGCAGTCTGAAAACGTCGTCGACAGATCTCTCATTGTTAAGCCAGTTAGTGAGGA
GCTCACTCCGTAGCTCCTGCGCGACCGTTTTTGTGTCTTTATACGACGACATGGCCACGCCAGGGCATGGGAAAAATAGTATAATAACAATATTACGGGT
ATTATATTTACGGAATAACTTACTATTGATTTTTCCAAGATAAATATAATACATAACTGTACACAATAATACAATATTTTACACGCTTCCAACCATTTCC
AGGAGCGCTGACAACCAACAGTTCTCTACTGCCTTGCAAATACACTCTGCGCGCTTTGATTCACACACTCCCCACTTCTCAATTTTCTCTTTAGAGAACA
AGCCACCACTCTTAGCCACGCTACCCACCACGCTACCCACGATGACCTCCCGTCAACTCTGCGCATTTTACTTCAGCGACCTCGGTGAAGGTCGCTTTGA
GTGTAAATCCTGTGGGCTTCCTCGGAAGCAGACGCCCGGCACGGGGTACAGCAACCTCCTCAGCCACCTTAACAGCAAGCACGCTGGGTATGCTGCTGGG
TTTGCAGAACTTCATGCCACGCAGACGCCAGCACTTACCACGTTTGGTTTTGTGGACGATGTGACGCGCAATATCTACCAATGGATGGTATGGGTGATCG
AGAGAAATCTACCAATCACTGAAGTGGAAAACAAGGCTACGCGTGCTGTAGTTACAATGAAGCCTACGACTACCAAGACACTGAAGCGGTACATGCGTCA
TGTGGCTCTAGCCGTTGGAGCAATCATTGCAAAGGAGATGGGAACTTCCTTTGCTTTAATGTTCGACGGTTGGACTATTCACTCACTTCACTTCCTCGGC
ATCTACGCGATCTACGTCTACAATGGTGTGCGCCACCAGCGCCTTCTTGCGCTTTCGCCAATGGAAGACGGCCAGACAGCTGAAGCCCACCTGGATCATA
TATCCACCGTACTGAGCGTGTACGAGAAGAACCTGCAGAAGGTGCGCTATGTTGTGGGGGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGGCTTCGGGTGAGGCGGGTTTGCTCCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTG
ACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGT
CGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGGATTGACTACAAGTGCTACCAAGT
GTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACTGGTCCCCTCTTTAATTAAA
GAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGTGGTTCATACAAACTATCAGTTACCTATAGAAATG
CAATGTCATTTAACCAATGGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCAC
ACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTACAACCCTTCTCGGTTGCATCGAAGACTAAGTGATAGCAATATATTGTGATTATTGCA
GTGATTATTATTGTGTTGCCAGGTATTGCAGTCTTTATTACGGATGTGATTCACGCAAAATAACAATGGGTATTGTATTTCCCATGCCCTGATGTAAGCC
ACAACACCATCTCCATAATGAGAGGAAAGCGCTCCAACCAACGAGGCCTTGCTGGTCGGATTCCATTCATTGTACATTGATATGTACCTGGCTAAAGTGT
GTCGGTTTGGATCCGATAATACGCTCATCATGTCACGATCCAGTCTGAGCTTCTTCAGTGCAGTTACCGGTTGCAAATCATCAGCGACCCACTTTTTGAA
AAGGGTGTCCTGCAATGCAGTTCCAAGATCGCGGGTGTGAGGTTCTTCCTTCCAAGCCGCCAGCACTCTCAAAAAAATGTCGTCTCCACCGAAGCCCTCT
GTAAAGGCATTGAGCACGTTTCTTGACCTGATTTCTCTCGGTTAAACAGTTTAATATAGTCGTCCAGTACCTCCACCTTTGGATCGATGAGATCCGGGTA
GCGGTCATCCCCGAGCTTTAGTCGCGGAAAAACTTCGGCGACAGATGTCTGACTCGTCAACCACTCAGTTAGTTGGTCACTCCGTAGCTGTCTCGCGAGT
GTCTCTGTGTTTTTATCCCACGACGCAATCACCAATGTGCCTGCAACGATGCCGTCTCCATAATGGGTCGAAAGAGTTTGAATCAACGACGTCATGCTCT
CTGCGTTCTTCGCATTGTACATGGAAATGTACCTCGTTAGAATGTCTCGA