Description :
From Genome Similarity Track
Location :
Scaffold_212:352- 3071
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_212-snap-gene-0.18Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_212-snap-gene-0.24Deoxyhypusine hydroxylase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_212-abinit-gene-0.36Deoxyhypusine hydroxylase

Sequence
2719 bases(100 bases per row)
CAATGAGGAGACACAGCAGTCGCCGCCACCAGTTGCCGACTCTCTGGTCGAGTATCACCGCAATATTGGCTGCTACCACTGCTATTTATTCGTCGGTGAG
GATGCGTACGACAGGATCGACGCGAACATGCTTCGCGTGCACATGGCGTTCCCACACGTGAAGCTGCTTCATGGAAGCTCCAATGGTGCAGACAACCACG
TGTGGTGGACAACGGAGATCGAGCGCAATGTGGACGAAGCGAGCTGCGCGGTCGAGGTCAAGGTGAGCTATTGTAGCTATTCAGTAAGCCATATTGCCAG
GGATCCTTGTGAATGTCTATATCTAATGATCATGTATGGATGGCATTAGGGCGATCATGTGTACGTGCGGCTGCCCGTGAAGGATGGCGACAAGGAGGTA
GCAGGTGACGGCTTTTCGTCATTCAGTCAGATCATGGCGAAGGAACTGGACAAGACGCAGTACGGGAAGCTCACGTGTCGATCCTGCGACAGTGTGCTGA
TGACGACCTCGCTGATCGACAAAGTGCTGCCGCTGCCGTCAGCGAACTGGATGGACATGTTTGACTTTTGGGGTGCGGGCATCGGGGCCTTTGAGCATCT
TCCGCGCGAAGACATCTTTGCGCACGCGGGCCGCGTGTACGTCGGGGAAGCGCACATCCTGCTGCATGAACAAGAAACCGTTGCTGACGCTCTAGAAGAT
GCGGATGCATCGGCCAAAGCCCAGGAACCTGGTCTCAGAGATACCGAAAAAGGCAATGATGTGACAAATGATGAGTCGTGGCAACCGCTTCGATGCTCGC
AATGCAAGGCTGCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGGCACCTCGAGAACCGACAAACCATTCGTCTCGAGAAGC
ATCTCATCTCGTCGTCTTCATCTGCTGCTGTTGATTCGAAAATTGACGCCAAAGAAGACATTTTCGCAAGATACACGGTTGACAGCATCGTGTGCACGAA
GCTGCTCGAGTTTGCCGATTCCGATGGCGTATTCCGGTATACGCTGCGCGCTGCAACAGAGGCTACTGCAGCTACTGCTCAACCGCCGTCTCTCCAGCTG
CAGTTGCTCAGTTGGGAGACGATGATCCAAGTGAAGAGCTCGGCCCCAGAATTTCGACGCGTGCTCAAAGTCCTGTACAGTGAAGAGTCAACTCCGCCAG
TGTTACCTGTGGCAGTGCCAGTCCCAGCGTCGCAGGAGCTGCTCTTTGCGCCTGTGGTCTGCGAAGCCATCGCTCAGCGTTTGCGAAAGAGCTCAGCGCT
GTTGCCAAAGACTTTGCAAACATTTAACAAGATGAACGTCGGGTACCTTTACGCATAAGAATCATCGGGAAAAGCGGCCCACAGCGATATAAAGGGACTG
AGATACGAAGGAACGAAAAGATCACAAACAAAGCCCAAAGAAGGAGTTTGCGCTTCCAAAATGCCACTATTGCAGCGTGTATATGTATCATATCAAACGT
CCAAAACGAAATAAAGAAAAGCGTCGCCTACTACCTCACTTACTTGGTTGGAGCCCAGTAGTCGATGGCGTCTAATGCGACCTCGCAGCTTTCGCGCACG
ACCTGCTCCGAGTCCTTGAGGTACACCTGGAGGATCTCCTCGCACTCGGGCGTGCCGATCGCGCCAAGCGCTTCGGCGGCTTCGTGGCGTACCATCTTGT
GCTCGTTGTCGTCCATCAGCACTTTCTTGAGCGCTGGTACGGTCACGGGGTTCTCCATCTGGCCCATGACGTATGCGATCTCGTGGCGGAACAAGGCGCT
CGAGTCGCTGTAGCCTTCGGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCGGCGTGTTGCGGTTGCGCAACGAGAACATGGCACGGTATCGGT
CGAACAGCGACTTGGTCGGGTCCAGCAGCGTCGCCTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGAGGTA
TGGGTTGCGGTCATGCTCGCCCTCCTGGATCTCACCGCGCGCCTTATCGACCTTGTACTTGATCAATCGCAGCGCCAATTGGCACGTCTCGGACACTTCA
GGCGCAGGATCCTTGCTATACTTCTCGAGCACAGGCAAGGACTGCTCGTGGCCAATGGCACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCATGCCGTCGTCGCTAGCGTCTTCAACGATCTTCTGCAGGATCTCGCATGCATCGGCGTCCTGGAACTGGCCGATCACGTACGCCAGCTCGT
GGCGCATCAGCTCGGAATCCTTCTTGTTCAGCAAGGCTGCAATTTCACAAAGCGCACATAAAAAAAAGGCAACTTTGTCAGTATCCTTGCCATTCAATTC
TCAAGCGCACTGCAATGCTGTCCTTGCATGGCATCAATCGCCAATCAAGTGCAGACAATGCAGCGCATACACATGCACACAACATATGCACACCAGCAAA
AGCACATGCAATCTACGCCCTTACGTACCTGTGAGGAGCACCTGGAGGTCTTCTTTCTGGCCGCGCGTGCGCAGGTAGAACACAGCGCGCGTGCGCTTGC
CCATGGGCTGGCTCAGGTCCAGCAGCGAGTCGCGCAGGGCATCGAAGGTCGGAACGCTCTCAGTGGCAGTCATGGTGATTGAGTCGCGGACGGCGGCGGT
GCTGGCGAGTGAGTCGCGG