Description :
From Genome Similarity Track
Location :
Scaffold_1399:352- 2457
Sequence
2105 bases(100 bases per row)
CCTTAAAAGCCATTTTGAAGCGTGAAGTATCAACCATAAACAACTACTCACCAcacttgctgtcgtgctAGCGAGCCAACATGGACTTACAATTCATAGG
CAATTCATACGGCGCTGCGGAGTACGCAGGTGCATACATTAGTAAGGCATAGCCAGATACACTTCGCTTTCGACGTGTGATTGTCAAAGCCGTTCATCGA
TGTGACCCTAACCTTTCGTATCACTCCATTTTGAAGCGTGTAGCCAACGCAACATTATCCGTTCGTGAAATTGGTGTTCCCGAGGTGATATACATTCTGC
CTCGCAATCTACCAATGCACAGTAAATCGCGCTCGATCAGAAAAACTAAAGTAATGCGTCACCATCTTCGCTATTACCGCGTCGAACCCCACAGCTTAGA
GGACCTTATTGCGTTGGCGGAGACCACACACGAAGATGCTCTTCGGATTGTGCCTATCGAGCGAGCATACATGAATCTCCCTCTGGATAATCGGTTTAAC
AGCATGAGCCTAGCTACATTTGCAGAAGAGTTCGAAGAAATTGATTCAATTGGCAAGCAACCCAGTACCAATGACATCTGGGAACGCATTGACGGAGAAG
GATGGATCAAACGGCGCACGAAGGCAATTGTAGTACAAAAATCACCATGGATCCGACCTGACACGTCAAACCCGAATTTTTGCTTCTCAGGACTATTTCT
ATGTGTACCGTGGCGATCGATAGACGAGCTCCCAACAACTGACGATGAGTACACTGAACACTTTTTCGAAGTGCCAGATACTCAACTAGATAGAGAACTA
CAACAAGAGTCTAATGCTAAGCTGGTTCGCCAGTATCAGTTGGATCTGCTAAAACAATCTCGCACGGCATCAATCATAACTTCGCTGCCACCGTCTGAAT
ACGTGTTCGTAACTAATCCCGATAATAACATATCGGCCCCGAATCGATGAACGTGAGCGATTCAACTATTGGCCAAAATGATGGGGTGGAGTGGAAAGCT
AGACACTCTTACTCATCGGCAATTGCTGATAAAGCTCGCAATTTTCCTAATGTATGCTTGAAGCCGTGGATGAAAGAGAAAAAAGATTCCCGTTCACTAG
GGAGCATATTCCGCCAAAGCGGAAGAAAAGGCTCACATTATCGCTACCCAATCCACGAGACGGAAGACATGCTGAACAAAGAAGAAACGATGGCCGAATC
GCAATGGATTCCTTTTGGGCTCGCAATGGAGCAATCTAGAAGTAGATTCAGGAGCTCACTTGAAACCTCGGTTTGCAAGCCCCTTCAGATGATTGTAAAC
GGTGAAGGAGGCTCAGGAAAGAGCTGGTTGATTCGGCATATTGTCAAAGATGCGCCCAATGTGTTTGGCGAACACGATGCAACACGAAGAACATCAAAAA
GGGTTCTCTTACTTTCTCGTCAGGGAACTGCTGCGTTCAACATAAAAGGAATGACACTGTGCTCTACCTTTGGATTCGCATCCTTTTCAAAAGCAGCATT
TTCCATTCCATTCAAGCCTTTGACGGAAGCCAAAACTGGACCAGCAAAGCTTAAACGAATGCAACAGCAATTTAGAGACGTACACCTAGTAATTATTGAT
GAGTTTAGTGTGATATCATGCGGAATTCTTTACTGGATAGATAAGCAGGTGCGTGGAATTTGGCCTAGTCATTCAGATGAGCTATTCGGCGGTAGAGATG
TGTACTTTAcaggagatgcagctcaACTAGATCCGGTCGTTCCAAACTCGCTGTCTACACCACTATCCAAAATCACTaatgaagtgcagcgccgtgGGAG
GGAAATTTGGAATAGTATCGCCAACGTGTGCATGCTAACAAGCCAAAATAGAGGAAGCCTTGACCCAGAATGGTTTAGCTCGCTTCGTCTATTGCGCCAA
AAGGCACAACCAAAGCTGACATAGACCTCTTTaactcgcgctgctcacAGATAATCGGTGAGCCAGAGTGGACGGCTAAAGCAAAGCTCATTGCATACAA
AAACGCTGATGTTGATGCCGCAAACGAGAAAAGCATCTTGTCAGCAAACACNGCGTGCGTTGTTGGCGGATACCCGAACTGTCAATATTGATCATGACAG
AGTAG