Description :
From Genome Similarity Track
Location :
Scaffold_2420:352- 1507
Transcript NameFunction/comments
Phyta_totarag14473hypothetical protein

Sequence
1155 bases(100 bases per row)
CGGAGTCCGTGGTGGACGTGTTGGTCGTGTGGAAGGTGCTGGTAATGTCGGGGTTGGGAGTGGAAGTTTCGGTGgatgtggagctggtggaggacgagAT
TCCCGCAGTGGTTGTGGAGCTGGTAGAGCTTTGATTGCGGTGTCACCGCAGCGGGTTACAGCTTCACCAGTGTCTACAACCCCCGATGATAGGTTGACGG
GAAGAACCGAGACACCGACGCGGTCACCTACCtttctgctgcagaacgTTTACATTGACAAGCTGGTGGTATTCGCACCGGACAAGGAAGCGTGGATGAA
GGCCAAAGTGTACAGACCAATTGAGACTGCGTACATTATTGGACGAGGGTATCGCTACGTCAAGAAAGGCAAGCAAGCTACGCTCTTCCAGGTGCGATGG
CTGNTgagctcgaagaagcagaggCGTACGAGGCGTTTGATCCTACAGATGTGCTTCCGACTAGTCTtgctgaagtggaagctATTCGGAACATGCGCTT
TATCCCATCCACACAGTTTGAAGTGCCTTCATACTTCTATCAGCACACCGACGGTTCAACCGAGAccttcctgctcctcgagTACAAACACGTATTCGAG
cattctgcttcttcgagtttTTCTGCGTATATCCGGCTGTACTTTTGGCGTCAAGTGGTTCATGAGACCAATAAGTACGCTGTGGCTAAGGACATTAGAA
CAACAACACCGTTCACGCTCCAAGAACTCATGACATTCTTGGGCATCATGTTCTTCATGGCCATGAATGATAAAGGCGAGTATGCGAACTATTGGGGTCA
ACGGCCTGAAGACCTCGTTTTTGGTGGAACTACGACTTCTCTAGACGGCGTCATGACTCTCACTTGGTTCAAGTTACTACGACGATGCCTCAGTTTCAAT
GCATATCCTACCACTTTGGAACAAGACCCGGCAGCTCGGATTCGACCACTCTTGAACTTGCTGAAAATTACTGGCGGTCagtatgtacatgtaggccGGA
ATGTTGCCCTAGATGAAGCCAACGTCGCATCCCGCTCGCGACAAGGACGTCACATGATTGTCTACAATTTATCCTATGAAGCCGACTGGTAAATACCATT
TTCGGTTGTACATGGTTTTCTGCTATACGACGTGGGTCGCGCTGAACTACAAGCT