Description :
From Genome Similarity Track
Location :
Scaffold_14:351989- 367659
Transcript NameFunction/comments
Hyaar_Emoy2802650mariner transposase putative
Hyaar_Emoy2802651prolyl endopeptidase, putative
Hyaar_Emoy2802652WD40 repeat protein, COMPASS complex protein
Hyaar_Emoy2802653hypothetical protein
Hyaar_Emoy2802654predicted protein
Hyaar_Emoy2802655esophageal cancer associated protein, putative
Hyaar_Emoy2802656carbohydratebinding protein putative
Hyaar_Emoy2802657AlNc14C146G7388

Sequence
15670 bases(100 bases per row)
CGTTGAAGTTGTCGTGTGTGCACCACACGACACGGGCACGAATCGCCCATTATTAGCCAATGCGAAGGGCCAAGCAAGACTGCGTCCAGCCCGAAGTGCC
TCGTCCACCAATTTCAAGACCCCTCATGACCACGTCCGAGCTCGCGTCGCCTTGTCCAGCTGCCGAGGCGCCGTGCAGCGCTCCTGGGTCTGTAGCAGAG
CTCCAAGTCAATGGAGAAGCTCCGCAAGATGCTGCTCTATCGTCTGACAAGAAAACGAGCGCCTGGAAAGAGCGTGGCAGCAAGAACTTGACGTACGAAG
AACGCCGCTCCATGCTCGATTTCCTCCTCAAGAGACGCGTCGACGGCACGTCCAAGCTCGTGCGTCACGCTGTCACAGACGCAGCCACAGAGTTTCGAGT
AGATCGTCGCACGGTCTCTCGACTGTGGAAACGAGCAGTGCAGAGTCTCGAGAATGGAGACGAAGTGTGTGACGTGGCGTCACGAAAAGTCGGACGTCGT
GGTCGTCGGAAGCGCGACTGGTCGGCTGAACTCAAGCGCGTGAAGGAGATCCCTGTGTCTCAACGAGGGTCGATCCGAGCACTGGCTGTTGCAGTGGGTA
TTCCCAAGACGACGCTCTACGAGCTCTTGAAAGAGGACGGGAGTCCTTGTATTAACTCAATTAAGCCGTCGCTCACGGACAAGAATAAACTGGACCGACT
GCGGTATTGCGCCGACAAAGTGCGACCGACTGGTCTATTTGACGATATGCACAATGTCGTGCATATCAATGTCAAGTGGTTTGCTTTTTCGAGGGACAAG
AAGACCAAAGTTATGTTTCTGGCAGCAGTGGCAAGACCGCAGTGGGATCTGCACAAGAACGAGTGTTTTGATGGCAAAATTGGCACGTGGCCGTTTGTGC
GGGAAGTAACGCAGGTACACAATGCAGATGGGCCGCAATTGCCGGAGCGAACGTTTGTTGCGCTGGAGACTGTGACGAAGGAAGATGTGCAGCGTATGAT
CACAGAGCTAGTGATCCCGGCCATTCGGCTGAACATGCCGGTGCATCTCATGCACGGTCCTATCTACATCCAGCAAGATAGCGCAAAGATTCGGTACTCG
GGTGACGCAAATTTTGCTGAAGAAGGACGAAAGCACGGCTGGAACATACAGATGCAGAACCTCCCGCCCTATTCTCCGGATTTTGTCGTGATGGATAGTG
CTTTGTTCAAACCTATCCTGGATGTACTGAAAACCTCGCCACCTCAAACGTCCGCGTCTTCGGTATCTGGGCTTGCAGAATTGATTTCTAGTGTGGAGCG
AGGATTTGCTTCGCTGACGAGAGATGACATTAATGACGCATTCTTGACGTTGCAAAAGGCGTTGGAATGCACAATGCGAGTCCAAGGCGCTAATACATAC
GAGCTCGGTCCTACTAGTAGAGAACAGCTCCAAATGGAGGGCAGTCTGCCTGTGAGTGTATTATGCGATCCTGCTGCATTGCTGGCGTGTCGGGCGGCGC
TTGATGATGCTGCAGAACAAGGTCTTGACGCTGTTTGAAATGACAATGGAGCCAATGTTGATATGTGCTTGTACGCACGACACTCTCAGTATGAAAAAAA
GTATGTATCCATGATGTATTTATCGCTTGATGCCGAGGCCGCGAACAGTGCGTTCATCATAGAGATGGCTCGTTGGTAACACAAGTCTTTGCAAACCGCC
ATCAATGGGTCATCCCTACCCTTTTCTCCTCTTCGCAGAAGCAGCGGAGCCCATGAACACACTGCGCGTCTTAAGCAACAAAAGTCGCACCAAGGTTCCA
CGCGATAAAGGCAAACACCTCGGACGTCTCCTCAATGATCTTCGCGGTGGGCTTACCAGCTCCATGACCGGACTTCGTGTCGATGCGGATAAGCAGGGGG
TTCGTCTGCGCCTCTGATCCACCGAGCTGATGTTGTAGCTCCGCGATGAGCTTGTACGAGTGCAGGGGCACCACACGATCGTCGTGGTCACCAGTAGTCA
GCAGTACTGACGGAAAGCCACCACGTTCTGCAAGCTTCTGCATGATCGGGCTATCAGCACGTGGCACGTTGTGAAGCGGCGAGTACTGCCGGATGTAGTG
AAAGTCGTCTGCCACCTCTGGGTCACCGTAGTCCGTGCGCCACGCGTGGCCAATGGTAAACTTGTGGAAGCGCAACATGTCCATAACGCCCACAGCACCT
ACTACACAACGGTAGAGATCAGGGCGCTGGTTGCTAGTAGCCGCCACCAACAGGCCGCCGTTGGATCCGCCATGAATCGCAATCTTTTCAGGGTTCGTAT
AACCTTCCGCGATAAGGTACTCGGCAGCTCCGTGGAAATCATCGAACACGTTTTGTTTTTTGTGCAGCATGCCATCTTGGTGCCATTGCTCTCCGTACTC
GCCACCACCACGCAAGTTCGGCAGCGCCAACATGCCATTAAAGTGCTGGACGAACACGAGTCGAGAAACACTGAAAGCCGGCGTAAGCGAGATGTTGAAG
CCGCCGTAGCCGTAGAGGTACACTGGTAGCTGACCGTTTTTCGGTGCGTTCTTACGCTTCACAAGGAACATGGGGATCTTCGTGCCATCCCTGGACGGGT
AGAACACTTGCTCCGTCTCGAATTGACTAGGATCGAAACCTTTCACCTTGGTTTCACGAAACACTTCAGTTTCAGGTGCCGTTGTTGAACCTGCTTCTGC
CTTCGACAAATCAATGCGAAAGATAGATCCCGGGTAGAGGAACGACACGAAGTGGTAAAACAGCTCCGACTCGGTGCGCTTGCTGGCCACCCCGACCGTA
CCAACGCTAGGCAATGGAATCTTGTACTGGTACACACCATCCAGGTTATACACATGCAGTTCATTGTGCACGTCCTTGACAATCTGCACAACAAGCAGAT
TCGGTGCCACTGGGTGTACATCTTCAATCACAATGGCATCAGGCTGTTCCGGGATCACCTCTTCCCACACAGGCGCAGCACATCCCTCCACAACCTTCGT
GCGCACCACACGCTCGCGCGGGGCATCGGCGTTCGTCTTGAAGTAGTAATAATCCCCATCATTAAGAACGTACGAGTACGCCGCATCCATCTCGTCCACC
AATTTCGTCACCGCAATCGTCGAGTCGCGCGGTCCCTTCAAGAAGCTGTCAAAGTCGCTCAAGTCTGCGACATGGACCATATTGGCATTTTTGCACCCAT
CTTGGACATACAAGAGCAGCTTGTTGCCATCGTCCGAGACTTCAGCACCGACATTAAACGTCGGTTTACTTGGGTACGCGTACACAAGTTTATCCTGCGT
CTGTGACGTGTGCAGCGCATGGAACCAGATCTGGTGGTTCAGATTTGCGTCTGTTTCTGTTCCTTTTTCCAATTGAATTGAATCCTTTTCGTCCTTCTCG
AGAGGTGGGTACCTCGAGTAAAAGAACCCTTTATCATCATGGGTCCAGCTAATGCTCGAGAACTTGACCCACTCGACTGTATCTTCGAGCATCTTGGTCC
CTTCATCTTGAACGTCCATAACGTGGATCGTCTGCCAGTCCGAGCCTCCACGAGAGATCCCATAGGCGAAAAAGAGCTTTCCATCGTTCAATTTCGACTT
GGAGAACGCCCGACTAGAAAGTGCAGCTGTCCCGTCTGCTGCCAATTGGTTCGGGTCCAAGAGCACGCGGGGCTGGCCTTGTAAGGTGTCTTGAATGTAC
AGCACGCTCTGGTTTTGTAACCCGTCGTTTTTACTGAACACGTACTTAGCCGTACCGTACTTACGAGGGGCCGAGTACTTTTCGTAATTAAAGAGATCGG
TTAAACGCGCTTTCGTTTCGGCGACATAGGGCACGGTATGACGCAATAGCTCCTGCGTCATATCGTTCTGCTGCGTGATGAACGTGCGTGTTTCGGCGGC
GTCCGGGTCCTCGAGCCAACGATAGGGATCGGACACTGGAACGCCGTGTAGATGCTCGACGATGTCGGCGCGGCGCACGGTCGGATACGTAAGCTTCTTG
GCGAGGCGACGTCCTGTCATGATCAGGGGTTCGTTATGCTCTTTTTTGGATTATGAAGGGGATGATGGGAGGGGTTTGTGGATGGTTTAGTTGTTGTGGA
ACGGAGAAATGAGAGCGGATATGATGTTGACGACGTGGACAGCGAATGATCGCGCAGGTATGATGTTGATGACGACAAACGCAGACACTATGATGTTTTT
TTGTCATGACGAGTAAAAAGGACAAAACATATATATATATGTCTTTCTATCTTCTTCTAATAAGTTAAAAAGATTACGTTTTTATTTGTACGCCCAAAAC
ATGGATTTTTCACGAGCCTTGCCACGTGCGTTATGACGCTGCACGGTATACTTTTGCAAGACATCACAGTGACCATGTGGAACCAAGCGCTGCGCCGCGT
CGTGCGCGCCGAGGAGCGGCAGTTCGACACCCGACGGCGACAGCAGCTCGCTCAAGCCACTGCATCTGCCTCCTCCTCATCCACTGCCATCCCACCAGTC
TCAGGCGTCGCTCCAGGAGGGTCGCAAGCACCATCAACCACCGCCACCGCTCCACCCGAAGCCAGAACCACCAAAACCGACAAGAATCAGATACTCGAAA
CCGAAAATAGTGTGGTACACACCGAATCAGAAACACACAATAATGACAATAATCACAATCAAGACGATGAAGAGGATGAGGAGGATGGAGATTACCTGCA
GAAGCACTTACTGTCGCGCTCGACGTCGGCCTGGAGCTGCCTAGAAGACACGCAGCAAGCCAATTGCTTGGCGCTGAATGCGTCGCTCACGCTCTTGGCC
GTGGGCGAGCGCGACGGACGCGTGACGATTTGGGACAATACGACGATCCGCGTGATTACGCGGGAGCTGGACCCGACGCTGATTGCGGTGCCGATTATAT
ACGAACAGAGTGATGTACAGACGAGGAAGAGGGACTCTGGAGAAGCACCGACGGGTGGGGAACAGAATGAGGGTCTTGCTGCTGCAAATGGGTTGGTAGA
AGGCAGGAAAAAGGAGAAGAAGGAGGAGGAAGAAGAGGAGGTGAAGACGCTAGAGATGGAGGAAACTGCTACTGCTAGAAACGAGGACAATGAAGAAGGG
ATTGGAGGGAGAGACGAGACGGGTAGGGGAGGAGCGGTGCTGACGCTCGTGGACCTTCAAGTCGTGAAGACGGCGTTGAAAGTCGTGTCGCAGTGTGCGT
GGTCGTGCGACTCGCAGTGGCTGTTTGCAGGCTGTGAAGAGAAATCCACGCGACGAGCGAGACTGTGTGTGTGGAACGTGGAAGCAGCGACGCTCGTGTC
GGCGTTTCAGTTTGACGGCACGATTACGGCATTGAGTACCCACCCTCTAGATCCAACGCTGGTTGTTGTGAGCTATTGGAATTCTCGTCCGGTACTGCTG
GACGTCGTGTCGGGCAAGCGTATAGTGTTGGAAAGCGTGCCGCTGGAAAACGAGGAGATGCCGCAATCGACGCCACAGAGCAACTCGAAACACCCCATGC
TTGCATCTTGTGCACGGTACGGACGTTCAGGGAAGCGCATCTACTGCGCCACATCGAAGTCAACGCTGGCTGTGCTGGACGCTGCTACTTTGCAGTGTCT
TGACAGTCTCAAGCTGAACGTGATCGTCCAGTTTGTGGATCTCTGCGTAAACTTACGTGAGACAGCAATGTTACTTACCAGCTCAAAAGGTATTCACGAA
TTTGCCATGGATTCGACCACAGCGACTGCTACCTCACAGCATGCATGCGATGCAGCATGTACTGGTGCAACGAAACACCCTATAGGGGTGCGCGAAGTAG
CACTGCACTCGACTGGCGCAGTGCGTGCACCGTGGGCGGTTTGCTGCTTTAGCGGTGGAGAGGAGTTTGTAGTTGGTACACCTGTAGTGCGCCATCGACA
CGTAGGCGAAAACGGTTTGTTCACGTGGCATCGCGCCTCCAAGATTGGTAGAACAGCAGCTCAGCACAATACTGGGGTAAAAGATGGTGTGCTGGCACTA
GCTTGGGATCGTTCGAGACAGAGTGTGCTCGCTGTTTCTACCAGTGGAGCTTTGCATGTGCTTGAGGAGCAGTTTACGACAACGTGGCCAGGGGCGATGT
ATCCTGCCGGCTTTCGTCTTATTACTGACAACGAAGTGTACTTGGACGTGTTCGATCGTGACGCAGAAGAGCGCAAACGTGAGAAAGAGGAGCTTACTGA
AGTAGCAAAGCGTTCCCCAGTCGATGTGTTTACTGTGAAGAGTCCAAGTTCCGAGTTTCCGAGCGAATGTGACATGGCCGACGCCGAGACGTCAGCCACA
AAACTGTGCTACATCCCGGCCATCCCGATAGAGCATTATCATCGTCAGCACCTCCATCAACTTCACGGAGGAGGCCACAACGAAGATAACGACTTTGGTC
TTAGCCAGAGCGTTTTCGAGCCGCTCAAGAGTGCGTTGGTCGAGCAGGAAAAGAAAAATGCTCGTAAATCCAGAAGCGGTGTTGGCAAAGTCCAGAAACG
GCGCCGCAAGTAGGCGTACAGCCAGTGTCCAGTGTCATACAGACATCAAACTTTGCGCTGAGCGTGTGGCAGGCAGTTTAAGAACGGATGGACAACTATT
GTCTTGGTGTGAGGAGAGTTGTCGATTACGGTTGCGCGATTTGACCTTGTCGAAGAGACGCTATCACTGCACGCAATACTTTCTAAGGAATCCTGAGCGT
TTCAGCTGTCCGACGTAAGTACTGCTGTCGCTGTCGCGCTGACTCATAAGTATAATGGACGGTCGTCAACCCATTAGCTACGAAAGCTCACGACATCTGA
GTTGACCTGGGACTTTTGCATGGGGCCGGTTCGATGGCTGCTTATGACGAGTTGCTGACGATCACATGGCTTTTGACGGAGTTTGTGATATCATGCATGC
TGCCTTGCTGTTCCGCTGCTGTCTAGTGGATTATGTCTCTCCAGCTAGACCCCAGCGAAGCTTCAAAGTCACTAACAAGAGCGCGAATCATGAGTCCCGA
CGCATACTTGGCCCAGCCGTACCGCAAGCGCATGTTCGTGCTGCATTGGATGCTGCCAGTGCTAGCCATGCAGCGTATTGCAGTCATGTTGTCGCTGGTT
GGACTTGAGTTGCCGCTTGTGCACTCAATGAGTCGTGACGATACTATGAGCAACAAGATGACACATCGGTTTCTCGTCCAGCTAAATGGCGAGCATGCAC
GATTCCCAGCTCCAGAATTGCTTTGTCTCGCACCATGAAGCGTTTTTCTCGACAGACACCATACATGATGGACCACGATGAATGGTAGCGGCAGGCCGGT
CTAGTGTGGCAAGGCATTATCACATTGAAACGAAAACAAGTGCAGTCAAACGGCGTCGTAATGGCTCGCCGTTGTGTCCATGTTGGATTGAGTTCTACTA
GAAGTCTCGGCTTTTGGTACGAAGGAGCATGGCAATGCCGGATTAACAAACATGTGCTGCTCTATGTCACGGTGCAACATATTTGCAAGGCTGAAGGCAT
CGCTGTAAACGGACTCCGTGGCAAGCTTTTGTTCGTGTATGGCGGGGCAATTCTAGACCTGGTGCAAACTCGTGGCTGGGTCTATGGAATGGACGGCATG
TTTGTGTTGTTGAAGCGTCGAGTGGAGCCAGAGGTCAGAGCGTCTGTGCAGAAGGAATTATTTCATGTGCATGTGGTTTACTTTGACCGGATCGCGCTTC
CAGCACTATCTGTGTTCCCCTTTTCTCGATTTTGGTGCATCGGTTGGCAAGGTGGTGTCGGGTGCTATCCTCGTTTAGCTTCGTTGTCTCTGTAATGATT
GTACTTGGCGTTTGGTGCATCCGAATGAGCTGGGGAATTCGACGCTAGTGGTTGCTGGAATGGCACCGGCATAATATTGAGGACTGTGCACTTGTAGCGT
GAAGCATTCGGAGTCAATGAGGAGATCAAGGCAACGGTCGTGGGACCACACAGAAGACCTGGGCAAGAATTGACAAATCACTTCTCAAACCGTCCTGCGC
TTTGGCACGAACTGCACAGCACGCGACGCCTGCTACCACTCTATTTCCGCTTGGGCATAGCTGCAGCTTAGATGTCTGCCGACAACCCATTGACGATGTG
GAGTGGATGAGTGAACATCTCTGTTACGAGGCGGGATGGGTAAATAAAAAGCTCTGAATACGAGGAATGCTGTTCGTCATGTGGTATTGTTCTTCACATC
CAGCTGATCAAGCGAACCACTGATTGTGAAAGCGACGTCATCGCTTTAGCTGAAACAGATGGCTACAGACAGATCAAGCACATTATTATCCGTGCAGCGA
CGCGAAGCACTGCTTCGAGAAGGGTCTTCTGCTGCAATATGCGCCGTCCACGAACGCTCGACGCCGTCACTTCTCGCCTCCTGTCATTCCACCCATCATG
CTTACCGGTTGTATTGTGGCAAGAATGATGCAGTCCGGGCCAGCGACCCTGCCAGTTGCATCATCGAATGTAGTGGTGGTCTTCCCTTCCGTGTAATCCC
GCCCTAGCTTGTGACTGACAAAGCGCGTCTTCGAAGTGGAGCTTGATAGCTGCTGGAAGTTTAGAATGAACCTGCAACGTCAATCAACATCCAACAGCTC
GTCCGTTACCAGAGCGCTCGTTGTTGTACGCTAACGCGATTGTGCAGATTGAAGCCAATTCAATGAGCTTTGCCATCTACGGTTCGACCTCATCTTTACT
CGGCGTCAGTAGTATGGACGCAGTAGTGACGCACTCGTACACTGGACATCCCACGTCTACCCAAACTGAAGACCTGGACTAGACGCTGTGCAGAAAATCA
GAGCGTAAACTGCTCCAGTGCTTCGACAAGAGATTGGATGGACTGCTGGCTGCTTGCTTCTGGATACATGCTGGTAACGCACTTCGACGTCTCCAGCATG
AAATCGATGATATACACGCGTGTGCTGTCAAAATAGTGACAGGCCGTCGAGGCCATTTGCACTTCGGTTGTTGCCGCTCCTCTCAGGTCGACTTGCTTCA
GTAATCGTGCTTTCTCGTAGCTGTACGTCATACACTTGCGAATCAACGCAAGACCAGAACGAAATTTCTTCCGTCGTCTGCTGTCACTATGACTGGTCTC
AGCGATTCCGTCTTCTCGAAACGAATCGCTCGTGGTCAGAGCTGCTCCAAGTCGGCCGTCGTCGCATTCAAGCACGGGGGCGACCAAGTTGACGAAGTCC
AACATAAGCTCGACCTGCGCTACTGTTACGCGCTCAGCGACAGTTCTATCCACGTTGCCGTTGTCCTCGCTGAGTTCGCCCAGTGCGTCGATGCCTTGCA
CTATTTCCTCAATGATCGAGCTGAAGTGTGCCTGGACTTCGTCGTAAAAAGCGTCTTCGCCACCGTGAAGCATATCATTCGAGTCTACACCATCTAGGCG
ATCTGGTAGCGACTGTTGTCCCCACAAAGCATAGACTTGAACAAGCATGAGTGACACGCGTACACGAGCAACACCTGCTTCAAGACCATGTGACAGCGAG
GACGAGTTCTGTGACATCCATTTCATACGCTCCAGCACAGCTTTGTGCAGCGCAGTGACAAAGTAGAAGGCGTCCTCGTCGTTCAGCGAAGGAGCATATA
CCAACACGTTCACCAAGTGAGCAATCGTTTGCAAAACCCGGCCAATAACGCTACTCGTGCTGCTGATGCTCTCTGGCTCAGACTGATGATGTACGTTTTC
ATCGCAGTTGCCAGCAAGTTGAAGTGCGTCGATATCCAAATCCGCGAGCAGTACGATGGCAGCTTTTACCAGTGCGTCCATCTGGGGGACACAACCTGTC
ACCAATGCTATATTTGCTGCCGACACCATGAGCTGCATCTTTTCAAGCGACGCTTCAACTGACGGTATTGTAATGTGCGCGAATGCCAAGCAGGATTGAA
TAAATCCGCGCCGCACATGAGCGTGCTTCTTGCTCTGGAAGTTTGACGATCCCACACTCCTGTACACACGTTTGTGGGAATGCATCGCGAGCCGGAGAAC
CATCGTGGAAAGTAGCATCCCGATTTGCTCAAGCTTGTAGAATGCACGACGGCAGTTTGTGTAAAGCATGAGCAACGCCTCCTGTTCTTCACCTTGTGCT
CGTTCACTCATAGTCGTATATTCGTTCACGTATCCAAGCCGGGTAACAAAAGCCGATATATCGCGGGTAGCCCCGGTGCGCTCTGACACGGTACTGAGAG
AATCAAGCGCATCGTGTACACGGCAACATACAGCCATAAGCGCGTGCGTCACGGCAGCCTCGGGGCCGACGACGTGAAGTCGTAAGGTGCCTAAGCGGTT
CGATGCTTTTTTCAAATCCCCGCTAACAAAGGCTTGCAAGACTTTCTTCGCCACATCCACACTAGATTCTCGCTTGAACATGCCCATGATAGTCTTCACG
CAACAAGAGACATGTTAGTGGCGGAAGACTGTAACGGTGCAAGTTACTCGGACACTCACCAAAAAGGCAGAGGACGGAATGAGTTTTGAAAAGAACTCGT
AGCTCTGCTTGGCTCCAAACACAACATTTTCGATCAGCTCGCCGAGTAGATTGTATGATCTCGGCGTAAGCTCTTCGGGTGTTGCCGCATCAAGATGGCG
AACAACGTCCTTGAGAAGGATAAGGGCCTCGCGATGCTGTCATCACATAACAGCACGGCTAACAGCGTTAGTTCGCAGCAGCAGTAGAAGCGATATACAT
CCCCGTACCGGAAAGTGGACCACAATGAGCTTCATGTAAGCTGCTGCACACTCCATATACTGTGCAATGTCTTTCTGAGAAGTAATGAACGACCACGAGC
TATTTAAGAACTGCAACTTCCCGCCCGGCTCGTTACCTGCGACACTAGTCGTCTTGCTCAGCTGCGTTGCAATTGTACTGTAAAGATGGCACTTGGAAAC
GAGAGACGGAGACGCGGTGCGAATTAGATCCACCATCACGCTAGGTGTTGCGGCATAAAATTGGGCACTAATATACTCGCATATGTGCTTTAACACCATC
GAATTGTCGACATACTTCCGGTAGTGCGCCAGCAGCGAATCGAATGTATCCTGAGTGGCCCCTGGAGCCACGCACTTAACGAGCCACTTCACAGCAGGTG
AATGCAGGGCCAGGTACTCTTCGTATTTCATCTTGTTCGTTAGCAACCAGTGCCCAAGCTTGTGTTGCCGGAACCAGTCGAACGCGTAAAAGTAGTCAAA
GAGACTGCTGCTCGCTATGACAGTATGGCCAGCGGGAGAGGTGATGCCCACCAGCTCGGAACTCGCTAACGACAGGTACAACCGAGCGTATAACGCGACC
ATCGGGTCGCCTACACCCCTAAGGCAAGTGAACGAACAAGAATAGCAGCGCAGCATTAGACTCGTTTGCGAGGATCTCGACAGCAGGTCAAATCACATAC
TTGATCATATTTGACAACCGTGCTACAATCTGCGAATACTCGTCGTCGCAAAGGAACCGATAACATCCAAGCAACGCAACCTCAATGTAGCTGAGATACA
GTGTTAGCCAGCGAAGTCAACCAGTAAACTGAGTTACGACGGCAAGAAAAGCCACGTACATGCGCGGAAGAAGTTCCCGAATGCAAGCCGACTTGTAAAA
CCAATTCCGACACGTTTCAATCGCTTGGACATTAATGTCCGATTTCCTAAAGCGCTCTCCCAGTGGTCGAGAAACAGGATGCCCATATTCATTCTCTGAT
GCTTGAGCGTAAATGCGATCAAACACAAGCTGTCCAAACGCATCAAGCACGTCCGTCACCAGCACAAACACGCATGGGTACAGCTGAGGTGCTGTCGTCG
TGTCTGCAAGTAGTTTCACACACTTGATGGCAATGCGTAACGCCTCGACTTTCCGGTGCTGCTCCCACGTAGAAATCAAGCGCTTCTGCATACCCTTCAC
TTTGGCCACATACTGACTGTGCGAGATGTCAGCATCTCGCCCGTGTTCGACCGGTTCAAGCAGCTCATCATCATCACTATGCTCCCCCACACGTCCACGC
TCAATCTGCAGCAGTCTTGTCCGTGTTTTCTCAATCAACGTCGTTGTCTCTGTTCTCTCGTCCGTCTTTTCGGTCGAAAACCAGTCACTACGTCGTCCCC
ACAACCTCTCGTGCTCCCGCTCCTTCACGTCGAGCACCTGTTCTTCAGCCCGGGACACATCATGGAAATAACCAGCCAACAGCTTCTCTCTGTCCTGCTC
TTTCCACTGCTTCTTGACTGTACGTGGCACAGTGCCAGCCACACTCGTGTCCCGTTTTTCCTCCATCTTTATAACCCCCAGAACCGGCTCCACAGACACC
TCTAATGGCCCAAGTCTCGAATTCTTCACATCTGTAGACAGCACGATACCTTCAGCTGAATCAGCGTCTTCTTCGTGCATTTCTACGAGCTCTGGTAGCG
CTTCCGTTGTCCTGATTGGCTTAAACCCTGCATCTTGACGCGGAAACGACCCCCACGGAGGTCCAGACGCTCCTGTTTCCGCTGCAGATACATACACAGT
AGACAGAGGATGCAGCTCGTCTTTTTTTAACGTACGCCACGCGAGAGCTCGACATGAACGAGGCGCTTGCCGCTTGCCCACGCGCCAACTCGCAGCTCGA
GTTGATGTCGGCATGTGATCAAATTCAAGCGTGCGGATTGGATAGAATACGAACGCTTTTCAGCCAATGAAAGGGATTATATCGATCAGTTTTTCGCACG
CGCGTAATAACGCACAAGATCGACTCGTGGTCCGCGTCTGTTTCTTCTTCACGCTGCCCTTGCGTAGCTTACCGGTACGCTGCGCTGTTCCTTACAAGTG
CTAGTGAAAGAGGGTAGGGTTGAGTATGTGTTAGCTACAAAGAGAGGCTTGTGCTGTTTCCTGGCCGTCACAAACGACGTGAATAATGAATCGCTCAGTA
ATTAATTGTCTCGTTTGTTTTTTGTATGCTCTCTGTGTTTGTATACATGTGCTACAGTCATTTGGATACGCTCAAGATACTTATCTACTGAAGCTCTAAT
TAGTCATGTTTGGAGCGACAGCAAGTGCACCGCAAGCAGCGTCCAGTGGCTTCAGTTTTGGCTCAAATGCTGCAGCACCTACGCCGTCGTCTAGTGGCTT
TAACTTTGGCGCGGCAGCAGCAGCTCCAGGAACAGGAGGAGGCTTTGGAAGTGCTGGGACGACTGGAACGTCGATGGCTCCTACTGCTGCTGGCATGACG
GGGTTCAATTTTGGTGCTCCACTGACGTCGACGGCTCCTGCAGCTTCGTCTGGATTTTCCTTTGGGGCAGCGCCTGTTGCAACACCTTCTCCAGCTAGCT
CTGGATTCAGCTTCGGAGGTACCAGCACAGCTCCGAGTACTGGTGGCGGCTCCGGCTTTAGCTTCGGAGGCACGAGCACAACTCCGAGTACGGGTGGTAG
CTCTGGGTTTAGCTTTGGTGGAACTGCTGCTCCGGCTGCAGCTGCTCCAGCTAGCTCCGGGTTCAGCTTTGGAGGTACGAGCACAACTCCGAGTACGGGT
GGTGGCAGCGGCTTTGGGTTTGGTGGAACTGCTGCACCTGCTGCCAGTTCAAGTGGATTCAACTTTGGAGGCACGAGCACAGCCCCGGCTGCTACTGGTT
CTGGGTTTAGCTTTGGTGGCACAGCGCCAGCTACTAGCTCCGCGCCATCGTTTGGGACTGGTGCTAATGCTAATGCTGCGACCACGGCGAAACCTTCCTT
TTTCGGACAGCAACCTGCAGCGAGTAGCACTGCAACGACTGGATTCGGGAGTGGTTTTGGCTTTGGGGCTAAGCCTGCAACTACGGGCACTGGATTTGGA
TTTGGCACAGGAAGTGGTCTTGCTACCGGCTCAAGCACTTTCGGTACAACAGGCTCGTCACTTTTCGGTGGTGGTGGTGGTTCTGGCTTTGGCACCGCAG
CACCTGGTACTGTGCCATCTGGCTTTGGTGCGACGCCTGCGTCCACTGCTCCAGCCCCGATCATCCTTGGCGCAGATGCCTCTGTTGCCCAGCTGAATAC
GATCAAGGCAGCCTACCAGGACCCCTCTCAGTCACGTTTCAAGTTCCTCATGTACAACACTGTTGACCCGATGCAGCGACATCTGTACGCTCGACCACCC
TACATCAGCGAACGTTTGTGGAACCAAGCAGAGCTTGACAACCCCGACCCGCCCAACTGTGCACCCGTTCCTATTTTGGGGTTTGACAATCTGCTCAAGC
GTATCAAGGCGCAGCAGGAGCACGCGGACAAGTACAACAAGCACACGGATGACCTGCGTGCACAACTAAATGAGATGGACAAGCACACGCGGGCAACCGA
AGAAAAGCTTGAAAAGTGCCGCCATGAACACGTGCAGCTCTTTCACTCACTGGTGAAAGTCATGCGGGACATTGAGCTGTTACAGAATTACGGCAAGCCT
CTTCAACACGAGGAGATGCAACTAGCGTACGTTCGTAGTCGTGCATCCATCGTGCGCATCACTGCCCGAAACTCACTGTTGTGTTATGCTTGACTGACAG
GACGATGCTGAAGAAGCTTCAGACGTTACTGAACTCGCCGGATCAGTACAAAGCGCGGCTGAAGGACTTCGTGTCGCTTCAGCATGTTTCAAAGGAGGCG
CAGCCACCGCCGACAAGTCAACTGAGTCCGCAAGATCTGCAACGACTCTATGAGGTGTGTATCTATCGTGCACGTAAAGCTCACTCTATTGGCAGCAAAG
GTCGTCAGTCTAACACCTGCGTACGAATGATGTCCACTCTGCAGCTAATGGATAAGCAGCGACAAGGAATGGAGCACCTGACGAACATCATTAACGACGA
CCTCGCGGACATCCAGCTCATCAAGGAAACGTGGCGACGGTAGATAGCCAGCCCAGCCCATTTTTTGCGTGCTGATCCATTCCTCATCAAGCAGCAGGTG
AAGAGTAACAAAGGATGCAACGTCGAATGACGCAGAGTATTTCCATCTTCGTCGTGCAAGACACACGACGTTGATCCTCCACCCATCACGCCACATTGCG
CTGACGTCAAAGAGCGTGAGACCACACGTGGGTCGAGCAAGACAAAGACTTTGACACACTCCCATGCAAACTGTTCTCAACTTGTGTGTACTTGCTGTTG
TTTTCTCTCTCTGTATCAGGCCAAAGCCGCTGCCTCGAGATACTCAACTAGGCTCCGTGTCTTTTTGTCTTGACCATATGTATGCATGTCTGTCTCCTTC
CCGTCTTCTGTGCGACTAACTACCACCGACACGAGTCCACTCTTCTTCTCCTTTGTCTTTTCTAGTGGTGGTACGGGTCCACATCGCCAAATGTCTCAAT
GACCAGAGGAGCTTCGTCAAACTGGTGGAGAGGAGGGGGCGACGAGAGGCACCACTCGAGCGTCTGGTGCACCTCGGGGATCACCACTTGCGGGTCTTCC
GTAGGCGTGTTCTGCACTGGAACGCCGTGTACTTTGCCGTCCGAAGAGAAGTGGGCAACAGCCGGACGCATGATGACGATGGACTTGGTGTTCACTATAA
AGGGGGAGGACAAAAGAGATCGTGCAATGTGAGACAAGAAATCAAAGAATGGGAGCTCCTAATGGCTCTGGGTACAGTCGAGACACGAGAGCGACACGTA
GAGGAAGAGGAGGGGGAGGAGAGAGGGGACATACCGGTCTTGAGAGAGCGCAGGGAGTGACGGAGGAGGC