Description :
From Genome Similarity Track
Location :
scaffold_15:35198- 36647
Transcript NameFunction/comments
Pl_112299conserved hypothetical protein

Sequence
1449 bases(100 bases per row)
AAAGCGTCCTGGTCACCGGCATTGAACTTCTTGTTCTTGTTGCTCTTCTTCTTGGGGGACGCAACCTTGGCAGTAGCAGAGACCTCAACAGCAACTTCAG
CGGGCTTCTCGGACGTGGGGCGAGACGTCTGCTCGTTAAACCACACCTTCTTCGCCTTCACGGCAACCAGCGATTCCGAAACAGCGCCCACAGTAGCAGG
TGGCAACAGACCGATCGTGCTGAAAGCGTCCAACTGTGCGAGAGGAAGGACAAGCTTGGCGTCCTTCTTCGCCTTCTTACCGTTGCGACCCTTCTTACTC
TTCTTGCCGCCACCTAGCATCATGAAATCCTCCTCCTTACGTTGCAGAGGCTTCATGCCGTCAAGCTCAACAGGTGCGGCAGCGGTCTCAGCAGCCTTAG
CATTCTCTTCCTTCAGCTCCTTTGCATAAGTCTTCTCCATGAAAAGCACCAAAGCATCGCAGAGGTCCATCTCGTCCTGGTACGGGTGGATCTTGGCCAT
CTCCTTCTCGTAGTCAACAAGCTTCGCTTCATATTCAGCCTTACGAGCCTCCTCCTCTTTCTGACGCTCAAGCTCCTTCTTCTTGCGGACCAGACGAATG
TTGTTGTAGTACTTGTCGTTCGCTTCCTTAAATTCTTTACGAAGAGCCTTCAGCGCCGTGAACTTCTCATCGAGCTGTTCCTTAATCTCCTTACGTTCCT
TCGCAAGGATCGGGAACTGGTCCTTCTTGTTCTCTTCCTCATTAAGACGGTAGAGTTCATCAAGTGCGGCCTTTTGCTGGTTAAGTTTCTCCTGAACAGC
ATCAATCTCTTCATTCTTCTTGGTCTGAAGAGCACGTGTCTCCTTAATGCTTTCATTCTGCTTCTCCACAACTCCGTGATCACCCGAGATGGCGCTAACC
TGGAGCTTCTGGGCCTGCAACTGCTCAATCTCCTTGATCACGCGCTTTTCCTCGTTCAGAGACATGGAGCTGGTCTCCTGCTTGTGCTTGAGCTCTGCAA
TAGCTGAGTCGTACTCGCTCTCCGAGCCAAACTTGAGGTTGGCACGTGCACTGCGTTGGTTCTTAATGGTCGAGTCCTTCTCGTCGCGTGTCTGACGCAG
ACGCGCCGTGATCTGGTTACGCTGTTGGATGAGGTTCTCCTTCTCACTGCGGAGAGCTGCAAACTTGGCCTTGGCCTCTTGGATCTGGCCGCCGTAGCCG
CCGCGGTTCGTCTTCAGGGCGTCCATCTCGGTGCGAATGACGTTCGTACGCGCCTGCAGCTTCTTGATGGCGGCGTCCAACTTGGCGATCTTGGCGTCGT
GCTCGGCCTTGTCCGGCTTGGGCAGACGCTCGATCACGTCCGGGATCTCCATGTCCACGGCGACAACAGGCTCTTCACTGCTCATCTTGTTGGGTGCAGG
TCTCACTATGAGGGGGATTTTGACTGGCATGTGCGTGGTTGCCACGTGG