Description :
From Genome Similarity Track
Location :
scaffold_86:35191- 39800
Transcript NameFunction/comments
g3136.t1 hypothetical protein PHYSODRAFT_553035
g3137.t1hypothetical protein

Sequence
4609 bases(100 bases per row)
TTATGTGGACCACACACAGGCTACCATTGGTTGATTTCCACAACAAGTTGCCGCCAACCAAAACAACTTAAACGGCATTTCTCGGTCGCCATGGCTCCGA
CTGCAGGTGGGTCATGCTGCTCCTGGTCTCTTGCATCGCTCTCCAATGGCTCTACAGCAATATCCACGTCTTTTCTAACCCCTGCACGCTTCTACTCCGT
CAGGAACTCGCCTGCGCTTCAAAAACACGCGCTCCAAGAAGACGCAACAAGCCAAGAAGGTCCCGTCGCTCAAGAACCGCATCCGTGGTCTCGAGCGCTT
TCTCAGTCGCGGGGTACATTCAAATTTGCGTTATAATAATTTTCAATGTGGTAGTCTAAAGATGATTGGGTGTTTGTAGGGTCTGGCTGATGCCACTCGG
AGAGCAAAGAAGGCAGAGCTGCAGCAGTTGAAGGAAGAGGTGAGTGGCTTTGCTTGAAATTAGTTGGGAATAGCTGGGAGCTGAAGCGGGTGTATTGTTA
TGATTGTGACAGCATGAGCAAAAGGAGAAGGTTGTTGTGGAGAAGAAGAATGCCGAGAAGTACAAGAGAGTGAGCTGCTAACGGTGCAGGTACTTGTTGA
ATGGGCACTAACAAATACTTTTGGTTTTAATTGTTAGCCGCGCTTTTTCGAGCGTGTCAAGGTAATGCGCAAACTGCGTCAGGTGAAGAACCGCATTGAG
CAGGTGAGGAAACGTGGAGTCTGTTGCTGAGGTTGCCGTTCTGTAGTGTTGCGCGTAATTCTCACTTAATTTGCTGCTACAGGCAACTGACGACGCTGAG
CGTGCTCAACACGAGAAGAAGTTTAAGACATACCGCGAGGAAATGATGTACATCTACTATTACCCGAGGACTGAGCCGTACATTGCGCTCTTTCCGTCCG
CGCCCCACTCGGCAGAGAATCAGAAGCGCCAAAAGGAGCTTCGCGCAGAAGCTATTGCTTCCTTTGAGAAGGAGCAGCCCATGGAAGCGTTCCACCAGTT
TTGCTTCAATGACAGCAAGACCAAGGATTCTAAATCTACCAATGAGGCCAGGCCTGCTGTGGAGCTGTTGCTCAAGAAGCCCACGAAGGAACAGGTGAAG
AAGCAGAAAAAAGCGCGTAGCAAGCGCGACAAGTCAGGTGAAAAGTCGAAACACACCCCAGCTCTTGTCGACCAAGATGACGACGATGAAATGCCTGATG
CGTCGAAGAGCGAAAGCGACAAAGAGGAACAGGAAGAAGAGCAGGAAGAGGACGACTTCTTCCTTTGATTTTGGCATTAATACGTCGGCTGAACTGTTCA
CTCGCTGTTGTGGTTCTTGAAATTTATTACTAATAGTCTTTACGCTGACGAGCTCATATGGGAAGAGGAAGGAGGATAACTTGGTCACAAAAGAATAAGG
CTGGCGAAAAGATGAGGAGGAATCTGGAGATCTCAAGATTCGCTCCACCTATATCAGGATGGATGGGCCGCTCGGAGTTATTGTTTGCTGCTCCGTGTCA
GCTATCATCTCAGCTTCGGCTTGAGATGCAGCAGCAAGAGCGTTCATGTTTGTAAAGCTGAAAGATCTGAAGGCATCTGAAAGGTTGGAATCGTCGGGGC
TACCGTACATGCCACTAGGGAACCGAAAGTGACTGTTGTTGTCCTCCATCACACCATCACCCATGTACTCGTCATCACGAGAAGCGCTCACCGCATCCAG
CGCTCCTAGAGCCCCTGCAGTCCCCCACGCCGAGTCTGGCGCACCTAAAGCCCCTGCTGGCGCCCACGACATGTCAACATCCGAGATGGAGACCGAACTG
CTGCTTGCATTGTTGTTCTCCGCGTCATTATCATCCTCAACTTTCGGGTCAGATGAGCTTAGTGACTGGGCATCGCTCTCAGGTCCAGAATCAACGTTCT
GACTGCTACTTGCGGAACGGGTAGTAACATCAAACTCATCGTCGTCAATGAAAATGTCGGTGAGATTCCGGTTGTTGAAATAACTGGTGTCGTTGGGTCC
CTCAAGAGTCGGTACAAACGGAGGCACGGAGTCCAAGATCGTGTCCCAGTTGATACCATTGAAGAAAGAATGCAGCTTGATATCCTCCCAGCCCATACGA
GTCGCCGGGTTCGCGTCGAGCAGCTTGTCTATCAAATCCACTGCCTCAAGTGACAAGCACTTCTCACCGTCGGGCCATAAAATTTGCCGCGCTATAATGT
TCTCGAAGATTGCGTCGACGGAGTCATCATTAAACGGTGGAAAGCCAACCAGCATTTCATACAGGATGATCCCAAGTGCCCAATAGTCCACGGGGGGACC
ATGAGGAGCATTAAGAATGATTTCAGGAGCCAGATAGTCAGGGGTTCCGCATCGCCCAAACGTTTGGTACGCAGACTTCTTTTTCGAGCTCCTCGAAACT
CGCCGCGGACGGGTAGGTGGGAAAGCAGACGACGCATCTCCCAGGGGTGTGCCAAGCAGGTTTTCTGGGTCCTGTTGGGCCATGGACTCGTCGTCGGGTT
CTGAATCGGTGTCACTAACAGCTACAGCTTCCTCGGACAAGCCGAAATCCGTCAGCTACGAGGCAAAAATACGGCGATTAAGCTCAGAATCGAGACGTTA
GGAATCATAAAGCAGTCAAGCGCACCTTAATGTGCCCGGTTGAGGAAAGCAAAATATTGTCTGGCTTCAGATCTCTGCAAATTGTATATCAAAGCACAGT
CAAATGGTTAGACGGAGGGTTGGATGAGTTGCTGTGCAAGCAATGCAACCGAAACAAGTTAAAGAGCAGTCCGAACCTGTGAACGCAGCTCTTGGTATGC
AGGTGATTGAGTGCGATTGCGATCTCAGCGATATAAACACATGCCACCTAGAATACAAGACATCGGTTATGGATCAATGTCATCGACAAGTCAAGCAGAT
GCACATGTTAGCTAACCTGTTCTTCCAGCTGAACAATGCACTCCAGCAACGACATGAAATCACCGCCAGGAAGATACTCCATCACCAAAAAGAGATTGCG
CCTATCGACAACAAAATAAATGCCCTCAAGTATAAGTCACTGTGCTCGACATGGAAGCTACCTATGATTGCATGCTTACTTGGTTTGGAACGTCCAGAAC
AGCTTCACAACGAAAGGGCTCACCACATTGGCCAGAATATTTCTCTCCGTCTCAATCTGTTCAATCTGTGGGGGCACACAACGGAGCAAGTGCTCAGTAC
AGCCATTGCTATGATTGCGAATACACTATCCAGCAGACAAGGGTCTGTACCTGCTTTTTGCGCAGCAAGTGCTCTTTCGCAAGCACCTTGATCGCATACT
GGTCGCCTGTCGTCTTCTTCCGCGCCAGATACACCTTTCCGAACGCCCCTTTCGAGATTGGTTTGATGATATGGAAATCACGAATAGAAACACGATAGGA
AACTGGCTTCAAGCTCGACCGTCGTGGTGCACGAAGCCCCTCGATATTTTCTATGTCCTCCAGTGATTTGGTGCGCTTCAGCGGCACTCGTATCACCTCA
AGAGGAGCCTGTTGGACCAACATTACCTTGTGAGACGCACGCATTTTACTCATCTTGGCATGGATCAAGTTGCGTAGCTGCGAGCAGTACTTGGTGCCAC
GTTCAACGGCAAAGCTGGACGTTTCCACCTCCTGTTGCCGTATTCTGTCGATGATTTTCACTAGTCGGGCACAATGTGCGAACGAATCCACACTGGTTAC
ATCACACGTTGAAGCTTGGATCGCCACAACACGCAGTGCATGGTAGATGTGCATCTCCTCCTGGTCAAATATGGACGACATCATCTCCGTTGCGAGCGTG
GCGTTAATCGATGCCGTAAGCTTCACCAGCGAATTGTTAATGCCGTCTGCTTCCAGCTCCACCCTCTTGGACAGCACACAGAAGTTGGTATGATCGTCCA
AGTGGTTGGCATCCACTTTTGTTTCACACAGTTTACACACGACCACGGCCTTGTTTGTGCGTCGGAACGTCACAGTCATGGGTCTCTTACTGAACTGTAG
ATTATCCAGCACGTCTTCAGGCGACATAGCATCCACAGCTCGTCCGTTCACAGCCTCCACCGACATCCCTTTTGTAATAGTAACTCCTGACGGGATATGC
ATGGCCACAGTGGCCCACGCCTCCGCGTGGACGCTCTTGATCACGACTTTGTTCTTTACTGCGTCGGACACGAACTCCAGTCCGAGGAAGCCATCTCCAA
AGGTCATATCGAAGGTCTCCGTCTTCTGGACGTTCTCAAACAAATCTCCACCGTCTTCCAGGTTGGATCCAGCCTGGTCTGTGTCTTGGTTCTCGTCGTC
GGACGCCAAGTGACGCCATTTGACGCGGTTCTTTTCCCAGCGGGTCAGTACGTCCTCCAGATCGTCTGGAGAGGCGTCCAGCAGCCCTGGCCGCGTGATG
GAGGCTACGTCGGCACTGAACGGCGGTACACTGAGTGTGTACTGGCGTTGCAGACGCTGAGGCTTGATCTCCAGCTTGAGCTCTTCGTGCAGTCGCTCCA
GTTCGCTGCTGCTGGTGCTGCTGTTGCTCGTGCGGCGGCCGCTGCGGTCCGAGGGGAGCTCGAGCTCCGCAACGCGGGCCAGGGCGAGCTGCTGGGGCCG
CTCGGCCAT