Description :
From Genome Similarity Track
Location :
contig_43:351870- 353098
Transcript NameFunction/comments
g7529.t1XP_009535833.1 hypothetical protein PHYSODRAFT_318886 [Phytophthora sojae

Sequence
1228 bases(100 bases per row)
CTCTTCCTCCCTATTGAACGGTGAGGTGGTTCGGAGCATCGGCGAAGTAGGTCTGTAGGATAAACGCGCGTGAGAGCAGCGGCTCGATCTCATTCTCAAC
CCAGTCCTTCGTCGGCAGGCTTTGCAGGAAGAGTACCAAGTCTTGGAACTCGAGCGTCTTGAGCGTCTCGCCAAACGTCATGAGAATGGCAGCGCAAACG
TACACGTGGAAGCCCTCGAAGCCCGAGTCTTCACACAAGTAAGTATCCCAAATGCGTACGATGCCGTCCAGCGGGAGCTCGCGCATGAGCAGGCAGTTCA
TCCAACGGAACGCAAACTGCACGAACTGCACATTCTCACGCTCCACAATGTGCCAAACAGGTCAGCATCGCAACGGTGCACCAGTTCCTCCATGCGCTGC
ACCATGCGCTGCAGGCCCGGTTGAGCAAACGTGTAGTGATCCTGGATATCGTCCAGCAACTTTGTCAGGCACCAGTAGCTGTCTGCCTCCACAATCTGCA
AGTTCTCGTCCGAGATCATCGACAAATCGCACGCCTGCGGCTCATCTGTACATCAAGCATCGCTGTCAGCACCAGCACCTTCATCGCCATGGCCAGTCAT
ATGGAGCTCTCGCTCGTTTACCGATAAAAGCCGAAAGAAATACGACTAAAAACGGGGTCATGAGGTCGTTGATTCCCTGCACGTAGCCACTGGCTGGGTG
CCGGATAGCCCATATATATAGGACGCGTTCCATGCACTGCATGCGCAACGAGGTCATCCACATTAGCATGGTACAAGCAACCCAAGCAATGCCACGGTCG
ACTCACCTGATGGATGCGCTCGCTTTGGAAGAGCTTAACATCAGCGTTGGTGCGTGGAATGTCGACGAGGATCTGGCGCAGCGTGGTTTGCTCACGCGTG
CCCCGATCAGTGTCCGGGATGTAATAATACTGCTGCAGCAGTTCTACGTATTCCTGTCGCTTTCGCTCCAGCATGGCGGCACGTCGATCTTTCTTCGACG
GCATGTAGCCCTGCAATCGAGAACAATATCACGGGGTGAGTTCATGGATTCAAGCCAAAAACGCACGCATAAGGCACCCGTACCAACAGCAGCCGCCAGA
CTGTAGGCCGATGCTTCGTAGGGACCCCACCCCAACTGAGCTTGCGAAGCTGGTCCAGGTCGATGACTTCCTTCTCTAGCAGTCGCTCGAACTGCATGTA
TCGAAGGTTCCCTGACGCATTCCGAGAC