Description :
From Genome Similarity Track
Location :
contig_43:351847- 353075
Transcript NameFunction/comments
g7890.t1ETO69714.1 hypothetical protein F444_13731 [Phytophthora parasitica P1976

Sequence
1228 bases(100 bases per row)
CTCTTCCTCCCTATTGAACGGTGAGGTGGTTCGGAGCATCGGCGAAGTAGGTCTGTAGGATAAACGCGCGTGAGAGCAGCGGCTCAATCTCATTCTCAAC
CCAGTCCTTCGTCGGCAGGCTTTGCAGGAAGAGTACCAAGTCTTGGAACTCGAGCGTCTTGAGCGTCTCGCCAAACGTCATGAGAATGGCAGCGCAAACG
TACACGTGGAAGCCCTCGAAGCCCGAGTCTTCACACAAGTAAGTATCCCAAATGCGTACGATGCCGTCCAGCGGGAGCTCGCGCATGAGCAGGCAGTTCA
TCCAACGGAACGCAAACTGCACGAACTGCACATTCTCACGCTCCACAATGTGCCAAACAGGTCAGCATCGCAACGGTGCACCAGTTCCTCCATGCGCTGC
ACCATGCGCTGCAGGCCCGGTTGAGCAAACGTGTAGTGATCCTGGATATCGTCCAGCAACTTTGTCAAGCACCAGTAGCTGTCTGCCTCCACAATCTGCA
AGTTCTCGTCCGAGATCATCGACAAATCGCACGCCTGCGGCTCATCTGTACATTAAGCATCGCTGTCAGCACCAGCACCTTCATCGCCATGGCCAGTCAT
ATGAAGCTCTCGCTCGCTTACCGATAAAAGCCGAAAGAAATACGACTAAAAACGGGGTCATGAGGTCGTTGATTCCCTGCACGTAGCCACTGGCTGGGTG
CCGGATAGCCCATATATATAGGACGCGTTCCATGCACTGCATGCGCAACGAGGTCATCCACATTAGCATGGTATAAGCAACCCAAGCAATGCCACGGTCG
ACTCACCTGATGGATGCGCTCGCTTTGGAAGAGCTTAACATCAGCGTTGGTGCGTGGAATGTCGACGAGGATCTGGCGCAGCGTGGTTTGCTCACGCGTG
CCCCGATCAGTGTCCGGGATGTAATAATACTGCTGCAGCAGTTCTACGTATTCCTGTCGCTTTCGCTCCAGCATGGCGGCACGTCGATCTTTCTTCGACG
GCATGTAGCCCTGCAATCGAGAACAATATCACGGGGTGAGTTCATGGATTCAAGCCAAAAACGCACGCACAAGACACCCGTACCAACAGCAGCCGCCAGA
CTGTAGGCCGATGCTTCGTAGGGACCCCACCCCAACTGAGCTTGCGAAGCTGGTCCAGGTCGATGACTTCCTTCTCTAGCAGTCGCTCGAACTGCATGTA
TCGAAGGTTCCCTGACGCATTCCGAGAC