Description :
From Genome Similarity Track
Location :
contig_83:35181- 36184
Transcript NameFunction/comments
g10390.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
ACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTC
CAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTT
TGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACT
GCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGAT
CAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGG
TTGCTTGGGAACGGCTTCTGGACCATTTTCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTC
GTTGTCGATCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGA
GGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGCGCCGTCGAACACGA
CTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTC
GCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATC
AAA