Description :
From Genome Similarity Track
Location :
Scaffold_133:35172- 37735
Sequence
2563 bases(100 bases per row)
ACTGTCGAAGCCCGTACGGCGCGACGACCTTCTGCGTTGGACGCTGCTGGTGTAGTAGGTTCACACGCCGGGAAAAAGACCCACGCCCGCGGCATTGCCT
CAGCGGAGCATGGTCTTGCTGTACGCAGAGCTGTCGGTGCGTTGACAGCTCCGTGACGCTTCTGCGTCCTGGCGGTCTGTATCAGACGCCCCAGTCATGA
CGGAGGTGGGAACATGACTCGCCAATGCTCCGTCATAGACCTGGACTGGTAGGCCCTTCTCAGCCTTGCCCCACCAAAGTCCGGGCTGTGCCTTATGGTC
GGCACAGCCATGTTGTTCATGGCGAGAACTGCGAGCGACACCGCGGTGCGCGAGTCCATCGAGCCGAAACGTTCAGGTCCGTTGAGGACCATTGGTACTT
CCTTCACCGTACCAAAGGCTAGTCCACCAAGGACCAGCCCACGACCGCCACGCTGACATAGAGTGCAGTCGGATGTCGCTATGCCAAGCGACGTTCCGGT
GGCGTATCAACGCCCCAGAAGTCATCCAACGTTCAAGGGGTACCGTACCCCCGTACACCGAGTGTACTACCAGCAGCCCATCACTGCCCTTCACCGGTTT
GAGAGAGCCACGTCTATCCGGGCTAAGTCCCGTGGTGCGCACAACCTGCACACCCATCACGAAGACTTAGCGCTCTTCACTAGGGCATACTGCCTCTACC
GGTGGCCGGGGAGTCTTCGTCCACCTGGCCGTGGCCTGCGCCACCGGACTTAGGGCCCACGGACCGTCTTCTTCCCGAGGACTAGCGAGGGACACACACG
CTGGTAGTGTCCATGTCCGCCGCATCCATTGCAGCGGACCAAGCTCTCGGCTGAGCTTAAGTCCATGGGTTCGGGCTCGCTGTACGCACCGGTACCAACG
GGCTGCGTGACAGCAGGAGCAACGGCGTCATTGCTGCGATGCTCCGCCTCCCGAGGAACGCCATTCTCATCGTGGCGATGTTCCTCTTCCCGAGGAGTAC
CAGCCTGCTTGTGGCTGTACTCTTCTTGAAGGGCGATTCGAATCGCCTCCTCCATAGTTGTCGCTTGCACCCGGAATAGCTGGGTGCGAGCAGGACCGAC
CTTCAGGCCGTCCATGAAGACTGTTGTCTTGACGTCTTCAGGCAGAGGATTCCCTGCCAGAGATGCCACCAACGTGCGCATCTCTTGCGCGTACTCCTGC
AGCTCACGTTTACCTTGCTTACACGCGAGAAAGCGTGAGCGCTGGCAGAACACATTGTTCGCCGGTAGGAACGCGGCTCGAAGCTGCTCACACAGCTGAG
CCCAGGATGCAAAGCATCCAGGAGATGTCGTCTCCCTGGTGTATGCCCAGTGCTTGGCACGTCCACCAAGGTTGGACAGGGCAAACGCCACCCGAGCTGG
CTCGTCCGAGATGAGACCCGCCTTCATGGCTATCTCCACCTCACGGACCCAGAAGTGAAGGTTCTCTCCTTCCTCCCCCTCAAACGCGGGGACCTTCAGC
CATACCGGCTTAGGTCTGGTTGCCTGAAGAGCGGCCATCGAGGCCTCCAAGCTCCCGCGGACGTGAGCGATAAGACCACGCTCGTAGGTCTCAAACGCAG
TCACACGTTCTTGTTGCTCGGCAGGCGTCGCCGCCGCCAAGCTGCGAAGGCCATCTTGCCCAACGATGCCTCCCATCTTCCGAACAGACTCGTACTGTGA
GTCGTTCAAGCAAGGAAACTCGCTTCGGTCCATCTTGGCTTCAACGTTGAGCGCACAGAGGATTCAGGTAGTTCAATCTACCCGCGATGGTGCTGGATTG
ACTACGAGTGCTACCAAGCGTGACGGGGTCACACAGCACCTTGCACAGAGGAAGTGCTTAGGGGTATTAACTACCCAAGTGAACGTTAGTCCACGTGTTC
CCGTCCTCAAAGGGAGCGGTTTGCTACTTAGAAGAGTAGATTTAAGACTGATGTATTTATAAGTAAGATAAGCTTGGGTCTCATACAAACTAGAGGTTAC
CTATAGTGGAGCTAAGTAGTCATGCACTGACTGGTTCCGAGAGCACCTGGTATCGTGTACCAGGTGTCCACAAGAGTGACGGGTCACTCTTTATGTAACA
TGGGGCACACTGGATTGTACCCCGTTACATCCTCCCGCACTTAACTGAGAATCACCTGGTTCTCCAATCACAACTGATTCTCCAATCAGAAAGGAGAGAA
TTAAAACACCAAAAGGTGAATTCTCACACTGAGCAGCCACGAGACTGGCGCGGCTCTCAGTCACACCCACAGTAACCTGTGCTGCCAAAGCTCACTGGGA
TTTGCATCCTTATGCTCACAACTGTGTTGGCCGCAAAGCCTACACTCAGAGCTGCCTTAGCTCCTGCGCTACCGCGCGTACAGTGCTTTGGTACAGGGTG
CAATAGCATCCGAACGTGTGGCATTCGCCCACAGCTCGCACCAGAGGACACGACAGTCCTCGCGAACGCGTCCGGAGCATGGTGTCTCCCGCGAGGGACG
ACACCGAGAAGGGCAACACCTTCCCCAGCACTAGAGGGAGCTCTCAGCTCACCTCGGGCCATG